Cart 19 Product Products 2 975,62 € (empty)
-
1 x RGS1...259,07 € -
1 x FAM163A-fa...113,40 € -
1 x TMPO-thymo...121,50 € -
1 x RASSF8-Ras...121,50 € -
-
1 x TSPAN12-te...121,50 € -
1 x PFDN2-pref...113,40 € -
1 x GPR52-G...121,50 € -
1 x CTSG-cathe...113,40 € -
-
1 x RPL7L1-rib...113,40 € -
1 x SLP-76...259,07 € -
1 x COX11-COX1...121,50 € -
1 x C12orf10-c...121,50 € -
1 x VDAC3-volt...121,50 € -
1 x Septin 2...259,07 € -
-
-
1 x PLD4-phosp...121,50 €
No products
To be determined Shipping
2 975,62 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 19 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 2 975,62 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 2 975,62 €
Data sheet of DKK2-dickkopf homolog 2 (Xenopus laevis) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DKK2-dickkopf homolog 2 (Xenopus laevis) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC126328 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DKK2 |
| Origin species: | Human |
| Product name: | DKK2-dickkopf homolog 2 (Xenopus laevis) Gene |
| Size: | 2ug |
| Accessions: | BC126328 |
| Gene id: | 27123 |
| Gene description: | dickkopf homolog 2 (Xenopus laevis) |
| Synonyms: | DKK-2; dickkopf-related protein 2; dickkopf 2 homolog; dickkopf homolog 2; dickkopf-2; hDkk-2; dickkopf WNT signaling pathway inhibitor 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccgcgttgatgcggagcaaggattcgtcctgctgcctgctcctactggccgcggtgctgatggtggagagctcacagatcggcagttcgcgggccaaactcaactccatcaagtcctctctgggcggggagacgcctggtcaggccgccaatcgatctgcgggcatgtaccaaggactggcattcggcggcagtaagaagggcaaaaacctggggcaggcctacccttgtagcagtgataaggagtgtgaagttgggaggtattgccacagtccccaccaaggatcatcggcctgcatggtgtgtcggagaaaaaagaagcgctgccaccgagatggcatgtgctgccccagtacccgctgcaataatggcatctgtatcccagttactgaaagcatcttaacccctcacatcccggctctggatggtactcagcacagagatcgaaaccacggtcattactcaaaccatgacttgggatggcagaatctaggaagaccacacactaagatgtcacatataaaagggcatgaaggagacccctgcctacgatcatcagactgcattgaagggttttgctgtgctcgtcatttctggaccaaaatctgcaaaccagtgctccatcagggggaagtctgtaccaaacaacgcaagaagggttctcatgggctggaaattttccagcgttgcgactgtgcgaagggcctgtcttgcaaagtatggaaagatgccacctactcctccaaagccagactccatgtgtgtcagaaaatttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - troponin T type 3 (skeletal, fast) - hypothetical protein LOC441476 - leucine rich repeat containing 19 - galactose-3-O-sulfotransferase 3 |