Cart 47 Product Products 5 898,06 € (empty)
-
1 x C2orf73-ch...113,40 € -
1 x FAM19A3-fa...113,40 € -
1 x TRIP15...259,07 € -
1 x RHBDD1-rho...113,40 € -
1 x C22orf39-c...113,40 € -
1 x RABAC1-Rab...113,40 € -
1 x TREML2-tri...121,50 € -
1 x KLF6-Krupp...113,40 € -
1 x ECE2-endot...113,40 € -
1 x BEND5-BEN...113,40 € -
1 x C21orf67-c...113,40 € -
1 x TRNT1-tRNA...121,50 € -
1 x TERF1-telo...121,50 € -
1 x ARHGAP11A...259,07 € -
1 x ELL-elonga...113,40 € -
1 x C14orf118-...121,50 € -
1 x PRPS2-phos...121,50 € -
1 x ASC-1...259,07 € -
1 x C20orf7-ch...113,40 € -
1 x WDR5-WD...121,50 € -
1 x SPHK1-sphi...121,50 € -
1 x EIF3E-euka...121,50 € -
1 x C20orf20-c...113,40 € -
1 x KIR2DS2-ki...121,50 € -
1 x UCN2-uroco...113,40 € -
-
-
1 x YEATS4-YEA...113,40 € -
1 x SPSB1-splA...121,50 € -
1 x CYB5A-cyto...113,40 € -
1 x FAM57A-fam...113,40 € -
1 x LDLRAD1-lo...113,40 € -
1 x SPCS2-sign...113,40 € -
1 x NMI-N-myc...121,50 € -
1 x MORF4L1-mo...121,50 € -
1 x SH3GL1-SH3...121,50 € -
1 x LHX5-LIM...121,50 € -
1 x EPHA10-EPH...121,50 € -
1 x IQCH-IQ...113,40 € -
1 x C20orf43-c...113,40 € -
1 x C22orf13-c...113,40 € -
1 x CDCA7L-cel...121,50 € -
1 x TAS2R45-ta...121,50 € -
1 x AHNAK-AHNA...113,40 € -
1 x SPIB-Spi-B...113,40 € -
1 x C2orf73-ch...113,40 € -
1 x FUT11-fuco...121,50 €
No products
To be determined Shipping
5 898,06 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 47 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 5 898,06 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 5 898,06 €
Data sheet of MRPL45-mitochondrial ribosomal protein L45 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MRPL45-mitochondrial ribosomal protein L45 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC130382 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MRPL45 |
| Origin species: | Human |
| Product name: | MRPL45-mitochondrial ribosomal protein L45 Gene |
| Size: | 2ug |
| Accessions: | BC130382 |
| Gene id: | 84311 |
| Gene description: | mitochondrial ribosomal protein L45 |
| Synonyms: | L45mt; MRP-L45; 39S ribosomal protein L45, mitochondrial; mitochondrial ribosomal protein L45 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcagcccccatacctcaagggttctcttgtttatcgaggtttttgggctggtggtttcggcagccagttctggtgactcagtccgcagctatagttccagtaagaactaaaaaacgtttcacacctcctatttatcaacctaaatttaaaacagaaaaggagtttatgcaacatgcccggaaagcaggattggttattcctccagaaaaatcggaccgttccatacatctggcctgtacagctggtatatttgatgcctatgttcctcctgagggtgatgcacgcatatcatctctttcaaaggagggactgatagagagaactgaacgaatgaagaagactatggcatcacaagtgtcaatccggaggataaaagactatgatgccaactttaaaataaaggacttccctgaaaaagctaaggatatctttattgaagctcacctttgtctaaataactcagaccatgaccgacttcataccttggtaactgaacactgttttccagacatgacttgggacatcaaatataagaccgtccgctggagctttgtggaatctttagagccctctcatgttgttcaagttcgctgttcaagtatgatgaaccagggcaacgtgtacggccagatcaccgtacgcatgcacacccggcagactctggccatctatgaccggtttggccggttgatgtatggacaggaagatgtacccaaggatgtcctggagtatgttgtattcgaaaagcagttgacaaacccctatggaagctggagaatgcataccaagatcgttcccccatgggcaccccctaagcagcccatccttaagacggtgatgatccctggccctcagctgaaaccagaagaagaatatgaagaggcacaaggagaggcccagaagcctcagctagcctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 2 open reading frame 60 - chromosome 1 open reading frame 38 - interleukin 29 (interferon, lambda 1) - zinc finger protein 2 homolog (mouse) |