Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of BCL2L2-BCL2-like 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about BCL2L2-BCL2-like 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC113522 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | BCL2L2 |
| Origin species: | Human |
| Product name: | BCL2L2-BCL2-like 2 Gene |
| Size: | 2ug |
| Accessions: | BC113522 |
| Gene id: | 599 |
| Gene description: | BCL2-like 2 |
| Synonyms: | BCL-W; BCL2-L-2; BCLW; PPP1R51; bcl-2-like protein 2; apoptosis regulator BCL-W; protein phosphatase 1, regulatory subunit 51; BCL2 like 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgaccccagcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggttatgtctgtggagctggccccggggagggcccagcagctgacccactgcaccaagccatgcgggcagctggagatgagttcgagacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcccaacaacgcttcacccaggtctccgatgaactttttcaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggctggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcggcgtctgcgggaggggaactgggcatcagtgaggacagtgctgacgggggccgtggcactgggggccctggtaactgtaggggccttttttgctagcaagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - kazrin - intelectin 2 - CD1c molecule - CD1c molecule |