PTXBC039387
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC039387 |
Product type: | DNA & cDNA |
Ncbi symbol: | LOC730441 |
Origin species: | Human |
Product name: | LOC730441-similar to trypsin X5 Gene |
Size: | 2ug |
Accessions: | BC039387 |
Gene id: | 730441 |
Gene description: | similar to trypsin X5 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atggtctatcttcagtccttcccagaaccctgcgtggggtctctcattcaccttgactgggtattgacagctgcccactgccccttacctgttgaaattcgactgggagtttctcaacctagcatcacaaacaagaaacaacagatatga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - intestine-specific homeobox - hypothetical LOC401260 - histone cluster 1, H1t - hypothetical LOC401260 |