Cart 3 Product Products 342,04 € (empty)
-
-
1 x IGF2-insul...113,40 € -
1 x HDGFRP3-he...113,40 €
No products
To be determined Shipping
342,04 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 3 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 342,04 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 342,04 €
View larger 
Data sheet of INDOL1-indoleamine-pyrrole 2,3 dioxygenase-like 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about INDOL1-indoleamine-pyrrole 2,3 dioxygenase-like 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC113496 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | INDOL1 |
| Origin species: | Human |
| Product name: | INDOL1-indoleamine-pyrrole 2,3 dioxygenase-like 1 Gene |
| Size: | 2ug |
| Accessions: | BC113496 |
| Gene id: | 169355 |
| Gene description: | indoleamine-pyrrole 2,3 dioxygenase-like 1 |
| Synonyms: | INDOL1; indoleamine 2,3-dioxygenase 2; IDO-2; indoleamine 2,3-dioxygenase-like 1 protein; indoleamine 2,3-dioxygenase-like protein 1; indoleamine-pyrrole 2,3 dioxygenase-like 1; indoleamine-pyrrole 2,3-dioxygenase-like protein 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgttgcattttcattattatgatacttcaaacaaaataatggagccccacagaccgaatgtgaagacagcagtgccattgtctttggaaagctatcacatatctgaagagtatggctttcttcttccagattctctgaaagaacttccagatcattataggccttggatggaaattgccaacaaacttcctcaattgattgatgctcaccagcttcaagctcatgtggacaagatgcccctgctgagctgccagttcctgaagggtcaccgggagcagcgcctggcccacctggtcctgagcttcctcaccatgggttatgtctggcaggaaggagaggcgcagcctgcagaggtcctgccaaggaatcttgcccttccatttgtcgaagtctccaggaacttggggctccctcctatcctggtccactcagacttggtgctgacgaactggaccaaaaaagatccagacggagacggagtctccctctgtctcccaggctggagtgcagtggcatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - radial spoke head 1 homolog (Chlamydomonas) - RAB, member of RAS oncogene family-like 2A - GIPC PDZ domain containing family, member 3 - family with sequence similarity 9, member A |