C17orf87-chromosome 17 open reading frame 87 Gene View larger

C17orf87-chromosome 17 open reading frame 87 Gene

PTXBC130556

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C17orf87-chromosome 17 open reading frame 87 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C17orf87-chromosome 17 open reading frame 87 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC130556
Product type: DNA & cDNA
Ncbi symbol: C17orf87
Origin species: Human
Product name: C17orf87-chromosome 17 open reading frame 87 Gene
Size: 2ug
Accessions: BC130556
Gene id: 388325
Gene description: chromosome 17 open reading frame 87
Synonyms: transmembrane protein C17orf87; C17orf87; UNQ5783; SLP adapter and CSK-interacting membrane protein; DTFT5783; SLP65/SLP76, Csk-interacting membrane protein; SLP adaptor and CSK interacting membrane protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggatactttcacagttcaggattccactgcaatgagctggtggaggaataatttctggatcatcttagctgtggccatcattgttgtctctgtgggcctgggcctcatcctgtactgtgtctgtaagtggcagcttagacgaggcaagaaatgggaaattgccaagcccctgaaacacaagcaagtagatgaagaaaagatgtatgagaatgttcttaatgagtcgccagttcaattaccgcctctgccaccgaggaattggccttctctagaagactcttccccacaggaagccccaagtcagccgcccgctacatactcactggtaaataaagttaaaaataagaagactgtttccatcccaagctacattgagcctgaagatgactatgacgatgttgaaatccctgcaaatactgaaaaagcatcattttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 17 open reading frame 89
- chemokine (C-C motif) ligand 4-like 2
- chromosome 21 open reading frame 96
- chromosome 17 open reading frame 87

Reviews

Buy C17orf87-chromosome 17 open reading frame 87 Gene now

Add to cart