Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of C7orf53-chromosome 7 open reading frame 53 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about C7orf53-chromosome 7 open reading frame 53 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC126149 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | C7orf53 |
| Origin species: | Human |
| Product name: | C7orf53-chromosome 7 open reading frame 53 Gene |
| Size: | 2ug |
| Accessions: | BC126149 |
| Gene id: | 286006 |
| Gene description: | chromosome 7 open reading frame 53 |
| Synonyms: | C7orf53; leucine-rich single-pass membrane protein 1; leucine rich single-pass membrane protein 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgactcattcttcccaggacactggttcttgtggcattcaggaagatggaaagctttatgtggtggattccataaatgacttaaacaaactaaacctctgtccagccggatcgcagcatctgttccctctagaggacaaaatcccagtccttggcacaaactcaggaaatggaagccggagtctgttttttgtggggctgctaattgtgctgattgtcagcctggcactggtttttttcgtgatatttctaatagttcaaactggaaacaagatggatgatgtgtcaagaagactaacagctgaaggaaaagacatagatgatcttaagagaatcaataacatgatcgtaaagcgactcaaccaactcaaccaactggactctgaacaaaactaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - secretoglobin, family 1D, member 4 - interleukin 29 (interferon, lambda 1) - mitochondrial ribosomal protein L45 - chromosome 2 open reading frame 60 |