Cart 1 Product Products 113,40 € (empty)
-
1 x JOSD1-Jose...113,40 €
No products
To be determined Shipping
113,40 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 113,40 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 113,40 €
Data sheet of TMEM69-transmembrane protein 69 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TMEM69-transmembrane protein 69 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC054041 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TMEM69 |
| Origin species: | Human |
| Product name: | TMEM69-transmembrane protein 69 Gene |
| Size: | 2ug |
| Accessions: | BC054041 |
| Gene id: | 51249 |
| Gene description: | transmembrane protein 69 |
| Synonyms: | C1orf154; transmembrane protein 69 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtccaaggccttggctttcctcatcatttccagcgtatatgagcaagacacagtgctatcatacatccccctgcagctttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - similar to trypsin X5 - intestine-specific homeobox - hypothetical LOC401260 - histone cluster 1, H1t |