FLJ11292-hypothetical protein FLJ11292 Gene

View larger

FLJ11292-hypothetical protein FLJ11292 Gene

Reference: PTXBC117434

Condition: New product

Print

Data sheet of FLJ11292-hypothetical protein FLJ11292 Gene

Brand	ProteoGenix
Product type	DNA & cDNA
Origin species	Human

More info about FLJ11292-hypothetical protein FLJ11292 Gene

Brand:	ProteoGenix
Proteogenix catalog:	PTXBC117434
Product type:	DNA & cDNA
Ncbi symbol:	FLJ11292
Origin species:	Human
Product name:	FLJ11292-hypothetical protein FLJ11292 Gene
Size:	2ug
Accessions:	BC117434
Gene id:	55338
Gene description:	hypothetical protein FLJ11292
Sequence primers:	Forward primer M13R (5'â†’3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â†’3'): TAATACGACTCACTATAGG
Orf sequence:	atgggactctggcagcaaatttcaaactgtatgccagacctggccctttgcagtgatataaaatttttcttgaggtgtctggaaagatggctgaataggaacagctctgctctgcagctcccagcgagatcaacgcagaaggagataatttctgcatttccaactaaagtacccagctcatctcattgggactggttagacagtgggtgcagcccacagaaggcaagcagaagcagggtggggtgtcgcctcacccgggaagcgcaaggggtcagggaactccctcccctagccaagggaagctgtgagggactgtgccgtgaggaacggggcattccggcacagatactatgctttccccacggtctttgcaacccacagaccaggagattcccttgggtgcctgcaccaccagggccctgggtttcaagcaaaaaactgggcagccatttgggcagacactga
Vector:	pDONR223
Delivery lead time in business days in europe:	10-12 days
Storage:	-20â„ƒ
Delivery condition:	Blue Ice
Related products:	- retinitis pigmentosa 9 pseudogene - RUN and FYVE domain containing 4 - lysophosphatidic acid receptor 3 - syntaxin 11

Reviews

Be the first to write your review !

Buy FLJ11292-hypothetical protein FLJ11292 Gene now