> >>KRTAP23-1-keratin associated protein 23-1 Gene
KRTAP23-1-keratin associated protein 23-1 Gene View larger

KRTAP23-1-keratin associated protein 23-1 Gene

PTXBC128435

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of KRTAP23-1-keratin associated protein 23-1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about KRTAP23-1-keratin associated protein 23-1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC128435
Product type: DNA & cDNA
Ncbi symbol: KRTAP23-1
Origin species: Human
Product name: KRTAP23-1-keratin associated protein 23-1 Gene
Size: 2ug
Accessions: BC128435
Gene id: 337963
Gene description: keratin associated protein 23-1
Synonyms: KAP23.1; keratin-associated protein 23-1; keratin associated protein 23-1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcctacaactgctgctgtggaaacttctcctcccattcctgtgagggctacctgtgctactcaggctactcccgtggtggctcctcgtaccccagcaacctggtctacagcactgaacctttgatctcccagcacctgccagctgggttcctctctctgcaagggctttcaggagacttgctgggaaacccctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - RAB27A, member RAS oncogene family
- keratin associated protein 4-11
- taste receptor, type 2, member 43
- major intrinsic protein of lens fiber

Reviews

Buy KRTAP23-1-keratin associated protein 23-1 Gene now

Add to cart