Cart 3 Product Products 342,04 € (empty)
-
-
1 x IGF2-insul...113,40 € -
1 x HDGFRP3-he...113,40 €
No products
To be determined Shipping
342,04 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 3 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 342,04 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 342,04 €
Data sheet of FLJ32063-hypothetical protein LOC150538 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FLJ32063-hypothetical protein LOC150538 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC113374 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FLJ32063 |
| Origin species: | Human |
| Product name: | FLJ32063-hypothetical protein LOC150538 Gene |
| Size: | 2ug |
| Accessions: | BC113374 |
| Gene id: | 150538 |
| Gene description: | hypothetical protein LOC150538 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtatggctgctatacaccaacagcttattctacaagaagtgcccccgaggaggattgggttaagctttgcaaatttggcttcccaggtaatgcgcttcattattctgctcccgacttacccaccacaccagtgggtacccggagcagcacccacttggcagaactgatgactgcttgggcccagcggagtgcgcattgcgctaacacgcgcacgggaattgcacccttgccggagcctccgcaccgtgcgcccttcaaagagctggcgaccccgctcacgtgtaagcaacctcccactttgaaactaattcgcacccgggtctttcaccccaaaggactttgctgcggacgctgctctgacccaagacgcgggagagaagtcccaaaggctacagccaggggctgggggactcctctgctcaccttagtccttgatttcgaaggccccaattaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - keratin associated protein 9-2 - RAB41, member RAS oncogene family - thioesterase superfamily member 5 - taste receptor, type 2, member 4 |