Cart 2 Product Products 663,74 € (empty)
-
-
1 x ANKHD1-ank...121,50 €
No products
To be determined Shipping
663,74 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 2 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 663,74 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 663,74 €
Data sheet of OAZ1-ornithine decarboxylase antizyme 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about OAZ1-ornithine decarboxylase antizyme 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC093652 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | OAZ1 |
| Origin species: | Human |
| Product name: | OAZ1-ornithine decarboxylase antizyme 1 Gene |
| Size: | 2ug |
| Accessions: | BC093652 |
| Gene id: | 4946 |
| Gene description: | ornithine decarboxylase antizyme 1 |
| Synonyms: | AZI; OAZ; ornithine decarboxylase antizyme 1; ODC-Az; antizyme 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtgaaatcctccctgcagcggatcctcaatagccactgcttcgccagagagaaggaaggggataaacccagcgccaccatccacgccagccgcaccatgccgctcctaagcctgcacagccgcggcggcagcagcagtgagagttccagggtctccctccactgctgtagtaacccgggtccggggcctcggtggtgctcctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - hypothetical protein LOC150538 - keratin associated protein 9-2 - RAB41, member RAS oncogene family - thioesterase superfamily member 5 |