Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of CCL25-chemokine (C-C motif) ligand 25 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CCL25-chemokine (C-C motif) ligand 25 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC130561 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CCL25 |
| Origin species: | Human |
| Product name: | CCL25-chemokine (C-C motif) ligand 25 Gene |
| Size: | 2ug |
| Accessions: | BC130561 |
| Gene id: | 6370 |
| Gene description: | chemokine (C-C motif) ligand 25 |
| Synonyms: | Ckb15; SCYA25; C-C motif chemokine 25; Ck beta-15; TECKvar; chemokine (C-C motif) ligand 25; chemokine TECK; small inducible cytokine subfamily A (Cys-Cys), member 25; small-inducible cytokine A25; thymus expressed chemokine; C-C motif chemokine ligand 25 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaacctgtggctcctggcctgcctggtggccggcttcctgggagcctgggcccccgctgtccacacccaaggtgtctttgaggactgctgcctggcctaccactaccccattgggtgggctgtgctccggcgcgcctggacttaccggatccaggaggtgagcgggagctgcaatctgcctgctgcgatattctacctccccaagagacacaggaaggtgtgtgggaaccccaaaagcagggaggtgcagagagccatgaagctcctggatgctcgaaataaggtttttgcaaagctccaccacaacacgcagaccttccaagcaggccctcatgctgtaaagaagttgagttctggaaactccaagttatcatcatccaagtttagcaatcccatcagcagcagcaagaggaatgtctccctcctgatatcagctaattcaggactgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - TBC1 domain family, member 27 - oncoprotein induced transcript 3 - spermatogenesis associated 12 - RAS-like, family 11, member A |