Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of KRTDAP-keratinocyte differentiation-associated protein Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about KRTDAP-keratinocyte differentiation-associated protein Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC130501 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KRTDAP |
| Origin species: | Human |
| Product name: | KRTDAP-keratinocyte differentiation-associated protein Gene |
| Size: | 2ug |
| Accessions: | BC130501 |
| Gene id: | 388533 |
| Gene description: | keratinocyte differentiation-associated protein |
| Synonyms: | KDAP; UNQ467; keratinocyte differentiation-associated protein; KIPV467; keratinocyte differentiation associated protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaagatcccggtccttcctgccgtggtgctcctctccctcctggtgctccactctgcccagggagccaccctgggtggtcctgaggaagaaagcaccattgagaattatgcgtcacgacccgaggcctttaacaccccgttcctgaacatcgacaaattgcgatctgcgtttaaggctgatgagttcctgaactggcacgccctctttgagtctatcaaaaggaaacttcctttcctcaactgggatgcctttcctaagctgaaaggactgaggagcgcaactcctgatgcccagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ATPase, Na+/K+ transporting, beta 2 polypeptide - spermidine/spermine N1-acetyl transferase-like 1 - IWS1 homolog (S. cerevisiae) - ATPase inhibitory factor 1 |