LOC152225-hypothetical LOC152225 Gene View larger

LOC152225-hypothetical LOC152225 Gene

PTXBC113576

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LOC152225-hypothetical LOC152225 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about LOC152225-hypothetical LOC152225 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC113576
Product type: DNA & cDNA
Ncbi symbol: LOC152225
Origin species: Human
Product name: LOC152225-hypothetical LOC152225 Gene
Size: 2ug
Accessions: BC113576
Gene id: 152225
Gene description: hypothetical LOC152225
Synonyms: uncharacterized LOC152225
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaataatagtttcaataaggaagacagaatgagttctgacacgatggttgggagctgtgacaggcagacgaaaaatggagccaaatggcatggaggtgtgtcatcactgctggattttaccttgatctacattcagttatctacttcttttcaaaatgctgggcattcattcaagaaacagcatatgtgttctgactttgaagtaatggatgaactgtcatgtgcagtatatggaaataagttttattaccttcttcccacattaactcatccatccattcaatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - hypothetical LOC152225
- thymosin beta 4, X-linked
- late cornified envelope 4A
- hypothetical LOC145757

Reviews

Buy LOC152225-hypothetical LOC152225 Gene now

Add to cart