KRTAP19-4-keratin associated protein 19-4 Gene View larger

KRTAP19-4-keratin associated protein 19-4 Gene

PTXBC117199

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of KRTAP19-4-keratin associated protein 19-4 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about KRTAP19-4-keratin associated protein 19-4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC117199
Product type: DNA & cDNA
Ncbi symbol: KRTAP19-4
Origin species: Human
Product name: KRTAP19-4-keratin associated protein 19-4 Gene
Size: 2ug
Accessions: BC117199
Gene id: 337971
Gene description: keratin associated protein 19-4
Synonyms: KAP19.4; keratin-associated protein 19-4; keratin associated protein 19-4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagctactatggcagctattacagaggcctgggctatggctgtggaggctttggtggcctaggctatggctatggctgtggatgtggcagcttccgcagactgggttatggctgtggctttggaggcaacggatatggctactgccgcccatcatgctatggaggatatggattctcaattctactgaaatcctaccctgaggacacgatatcagaggtcataagaagatcattcaatttaaccaaatattga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - keratin associated protein 23-1
- RAB27A, member RAS oncogene family
- keratin associated protein 4-11
- taste receptor, type 2, member 43

Reviews

Buy KRTAP19-4-keratin associated protein 19-4 Gene now

Add to cart