Cart 19 Product Products 2 955,00 € (empty)
-
1 x C-Reactive...544,00 € -
1 x M6PR-manno...121,50 € -
-
1 x SPANXE-SPA...113,40 € -
1 x ARC-activi...121,50 € -
1 x SMCP-sperm...113,40 € -
-
1 x TM4SF18-tr...113,40 € -
1 x GC-group-s...121,50 € -
1 x NEU4-siali...121,50 € -
1 x TMEM31-tra...113,40 € -
1 x PLA2G2D-ph...113,40 € -
1 x C20orf177-...121,50 € -
1 x WDR53-WD...121,50 € -
1 x CCL22-chem...113,40 € -
1 x PRRG4-prol...113,40 € -
1 x MGC87631-s...113,40 € -
-
No products
To be determined Shipping
2 955,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 19 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 2 955,00 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 2 955,00 €
Data sheet of LOC200261-hypothetical protein LOC200261 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about LOC200261-hypothetical protein LOC200261 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC117361 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LOC200261 |
| Origin species: | Human |
| Product name: | LOC200261-hypothetical protein LOC200261 Gene |
| Size: | 2ug |
| Accessions: | BC117361 |
| Gene id: | 200261 |
| Gene description: | hypothetical protein LOC200261 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcagaagccacctgccccacacagggggccgctttccctgcatctggcactcaccaggacagtcatagaactggccttgggtgcttggggagagtggagaggtctggggggcatccactggcctcagcctcagagcttctcatcagtaacccaggaggcaaaggcccagctcgagattagcccaggccactgtatctgtgccaagacctacagctgtccctgcagggcgtgcatctctgcagcccaggctatcacaatggtgtcccttttggtggggatgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - hypothetical protein LOC642947 - hypothetical protein LOC284100 - hypothetical protein LOC134466 - tetra-peptide repeat homeobox-like |