KRTAP12-1-keratin associated protein 12-1 Gene

View larger

KRTAP12-1-keratin associated protein 12-1 Gene

Reference: PTXBC127648

Condition: New product

Print

Data sheet of KRTAP12-1-keratin associated protein 12-1 Gene

Brand	ProteoGenix
Product type	DNA & cDNA
Origin species	Human

More info about KRTAP12-1-keratin associated protein 12-1 Gene

Proteogenix catalog:	PTXBC127648
Ncbi symbol:	KRTAP12-1
Product name:	KRTAP12-1-keratin associated protein 12-1 Gene
Size:	2ug
Accessions:	BC127648
Gene id:	353332
Gene description:	keratin associated protein 12-1
Synonyms:	KAP12.1; KRTAP12.1; keratin-associated protein 12-1; high sulfur keratin-associated protein 12.1; keratin-associated protein 12.1; keratin associated protein 12-1
Sequence primers:	Forward primer M13R (5'â†’3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â†’3'): TAATACGACTCACTATAGG
Orf sequence:	atgtgccacaccagctgctcctcgggctgccagccagcctgctgcgcgcccagcccctgccaggcatcctgttacatccccgtgggctgccagtcctccgtgtgcgtgcccgtgagcttcaagccagccgtgtgtgtgcccgtgagatgccagtcctctgtgtgcgtgcccgtgagctgcaggcccgtcgtgtatgcggctccctcctgccagtcctctgggtgctgccagccttcctgcaccagcgtcctctgcagacccatctcctgcagcaccccttcctgctgctga
Vector:	pDONR223
Delivery lead time in business days in europe:	10-12 days
Storage:	-20â„ƒ
Delivery condition:	Blue Ice

Reviews

Be the first to write your review !

Buy KRTAP12-1-keratin associated protein 12-1 Gene now