Cart 4 Product Products 458,74 € (empty)
-
1 x TECTB-tect...121,50 € -
-
-
1 x CDC37L1-ce...121,50 €
No products
To be determined Shipping
458,74 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 4 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 458,74 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 458,74 €
Data sheet of KRTAP13-4-keratin associated protein 13-4 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about KRTAP13-4-keratin associated protein 13-4 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC131691 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KRTAP13-4 |
| Origin species: | Human |
| Product name: | KRTAP13-4-keratin associated protein 13-4 Gene |
| Size: | 2ug |
| Accessions: | BC131691 |
| Gene id: | 284827 |
| Gene description: | keratin associated protein 13-4 |
| Synonyms: | KAP13.4; keratin-associated protein 13-4; keratin associated protein 13-4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcctacaactgctgctctagaaacttctcctcccgctcctttgggggctacctgtactacccaggctcctaccccagcagcctggtctacagcactgccctctgctctcccagcacctgccagctgcgttcctctctctacagggactgtcagaagacctgctgggagcccaccagctgccagaaatcctgctaccgccccaggacctccatcctctgctgtccctgtcagacgacttgctctggatctctaggctttcggtccagcagctgtcgctcccagggctatggatctaggtgctgctactcgctgggaaatggatccagtggcttcagattcctgaaatatggaggctgtggttttccttccctgagttacggatccagattctgctacccaaactacttggcttctggagcctggcagtcttcttgttacagaccaatctgtggatctcgcttctatcaattcacctgctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - keratin associated protein 12-1 - ribosomal protein S6 pseudogene - coiled-coil domain containing 88C - keratin associated protein 19-4 |