> >>FTO-fat mass and obesity associated Gene
FTO-fat mass and obesity associated Gene View larger

FTO-fat mass and obesity associated Gene

PTXBC030798

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of FTO-fat mass and obesity associated Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FTO-fat mass and obesity associated Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC030798
Product type: DNA & cDNA
Ncbi symbol: FTO
Origin species: Human
Product name: FTO-fat mass and obesity associated Gene
Size: 2ug
Accessions: BC030798
Gene id: 79068
Gene description: fat mass and obesity associated
Synonyms: FTO, alpha-ketoglutarate dependent dioxygenase; alpha-ketoglutarate-dependent dioxygenase FTO; ALKBH9; BMIQ14; GDFD; AlkB homolog 9; fat mass and obesity associated; fat mass and obesity-associated protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagtggaggaaagtcagcgaatgtaatagtgtcgaaccctgcagggaagttaagaagtggccataccgttgcattcatcatgggaagaatttcagtagaatgacaaatgctgtgcttcatgaagttaaaagagaggggctccccgtggaacaaaggaatgaaatcttgactgccatccttgcctcgctcactgcacgccagaacctgaggagagaatggcatgccaggtgccagtcacgaattgcccgaacattacctgctgatcagaagccagaatgtcggccatactgggaaaaggatgatgcttcgatgcctctgccgtttgacctcacagacatcgtttcagaactcagaggtcagcttctggaagcaaaaccctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - hypothetical LOC149950
- chemokine (C-C motif) ligand 8
- chemokine (C-C motif) ligand 7
- hypothetical LOC149837

Reviews

Buy FTO-fat mass and obesity associated Gene now

Add to cart