Cart 3 Product Products 1 114,25 € (empty)
-
-
1 x ANKHD1-ank...121,50 € -
No products
To be determined Shipping
1 114,25 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 3 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 114,25 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 114,25 €
Data sheet of hCG_2042718-hCG2042718 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about hCG_2042718-hCG2042718 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC127725 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | hCG_2042718 |
| Origin species: | Human |
| Product name: | hCG_2042718-hCG2042718 Gene |
| Size: | 2ug |
| Accessions: | BC127725 |
| Gene id: | 642204 |
| Gene description: | hCG2042718 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaagttattcgccttcgggagccgcaggggccagacggcccagggctctatagaacatgtctacacgggttccggataccgaatccgggactccgaactgcagaagatccacagggcagctgtcaagggcgacgccgcgggggtggagcgctgcctggcgcgcaggagcggagacctggacgccctggacaagcagcacaggctgtccattgccaggaagaggcttgcgccgttattctgctggaacatggcaccaatccaaaccttaaggatatctaccgcaacactgctctccagtatgctgtgtatagtgagagcacctcactggcagaaaaactgcttttccatggtgcaaatattgaagcactggacaaggtatagatcaatcaactttctttccaaaatatttgttttaacattgacatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - cadherin-like 29 - trefoil factor 1 - forkhead box N3 - metallothionein 3 |