Cart 26 Product Products 2 964,37 € (empty)
-
-
1 x CCDC33-coi...121,50 € -
-
1 x RAN-RAN,...113,40 € -
1 x CHRM2-chol...121,50 € -
1 x MTCP1-matu...113,40 € -
1 x TPD52L1-tu...113,40 € -
1 x PPP4C-prot...121,50 € -
1 x ZFC3H1-zin...121,50 € -
1 x CCDC51-coi...121,50 € -
1 x MSRB2-meth...113,40 € -
1 x UBL4B-ubiq...113,40 € -
1 x GMPR2-guan...121,50 € -
1 x TBPL2-TATA...121,50 € -
1 x PRKAG1-pro...121,50 € -
1 x SALL2-sal-...113,40 € -
1 x LOC255025-...113,40 € -
-
-
1 x STAMBP-STA...121,50 € -
-
1 x FLJ44881-F...113,40 € -
1 x B3GNTL1-UD...113,40 € -
1 x LOC400707-...113,40 € -
1 x TUBA1B-tub...121,50 € -
1 x PRCC-papil...121,50 €
No products
To be determined Shipping
2 964,37 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 26 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 2 964,37 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 2 964,37 €
Data sheet of TMEM220-transmembrane protein 220 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TMEM220-transmembrane protein 220 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC127705 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TMEM220 |
| Origin species: | Human |
| Product name: | TMEM220-transmembrane protein 220 Gene |
| Size: | 2ug |
| Accessions: | BC127705 |
| Gene id: | 388335 |
| Gene description: | transmembrane protein 220 |
| Synonyms: | transmembrane protein 220 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgccagcgctgtggcgggcctgcaacggactcatggccgccttcttcgcgctggcggccttggtgcaggtaaatgacccagatgcagaggtgtgggtggtggtgtacacaatccctgcagtactgaccctgcttgttggacttaaccctgaagtcacaggtaatgttatttggaaaagtatctctgcaatacacatactcttttgtacggtgtgggctgttggcttggcgtcctacctcttgcatcgtacacaacagaacatcttacatgaggaagaaggcagggagctgtctggtctggtgattattacagcatggattatcctgtgccacagttcctcaaagaatccagttggtggaagaattcaattggctattgccattgtaatcacacttttcccatttatctcatgggtctacatatatattaacaaggaaatgcggtcctcttggccaactcactgcaagacagtaatttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - transmembrane protein 107 - ribosomal protein S27-like - transmembrane protein 208 - transmembrane protein 213 |