Cart 21 Product Products 2 435,58 € (empty)
-
1 x TCEAL4-tra...113,40 € -
1 x SNAPC3-sma...113,40 € -
1 x C6orf141-c...113,40 € -
1 x FLJ36144-h...121,50 € -
1 x RHOC-ras...113,40 € -
1 x FCGR3A-Fc...113,40 € -
1 x GRAMD3-GRA...121,50 € -
1 x VASH2-vaso...121,50 € -
1 x ASPSCR1-al...121,50 € -
1 x DIRAS2-DIR...113,40 € -
1 x MBD3-methy...113,40 € -
1 x ATRNL1-att...121,50 € -
1 x C1orf59-ch...121,50 € -
1 x MARVELD3-M...121,50 € -
1 x RAB5B-RAB5...113,40 € -
1 x RABL2B-RAB...113,40 € -
1 x HIST1H2AL-...113,40 € -
1 x TNP2-trans...113,40 € -
1 x C9orf80-ch...113,40 € -
1 x BXDC5-brix...121,50 € -
No products
To be determined Shipping
2 435,58 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 21 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 2 435,58 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 2 435,58 €
View larger 
Data sheet of DKFZp434K191-hypothetical locus DKFZp434K191 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DKFZp434K191-hypothetical locus DKFZp434K191 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC051721 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DKFZp434K191 |
| Origin species: | Human |
| Product name: | DKFZp434K191-hypothetical locus DKFZp434K191 Gene |
| Size: | 2ug |
| Accessions: | BC051721 |
| Gene id: | 29797 |
| Gene description: | hypothetical locus DKFZp434K191 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaagaaaagacacagagaaggatgtgacatgcctgggccatggagcactctgagatctcatcgtggacaccactgcccacacctccatcccgtcctgcgcaggccgacactcactgacgttgaaggctgccttcagtgcctggatgtctgcggccaccccagacatgcggtagatgcccacctcctccatgcctcggcgctcgatctcctccacgcactggcgcacgatgtagggcaccttggacctctctctcctgcgggaggagggaatgttctcagtgtcctaacagccctgcttgggccataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - hypothetical locus DKFZp434K191 - chromosome 17 open reading frame 58 - chromosome 17 open reading frame 73 - chromosome 1 open reading frame 130 |