Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
NUDT1-nudix (nucleoside diphosphate linked moiety X)-type motif 1 Gene
PTXBC051375
New product
Data sheet of NUDT1-nudix (nucleoside diphosphate linked moiety X)-type motif 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NUDT1-nudix (nucleoside diphosphate linked moiety X)-type motif 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC051375 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NUDT1 |
| Origin species: | Human |
| Product name: | NUDT1-nudix (nucleoside diphosphate linked moiety X)-type motif 1 Gene |
| Size: | 2ug |
| Accessions: | BC051375 |
| Gene id: | 4521 |
| Gene description: | nudix (nucleoside diphosphate linked moiety X)-type motif 1 |
| Synonyms: | 7,8-dihydro-8-oxoguanine triphosphatase; 2-hydroxy-dATP diphosphatase; 8-oxo-7,8-dihydrodeoxyguanosine triphosphatase; 8-oxo-7,8-dihydroguanosine triphosphatase; 8-oxo-dGTPase; mutT human homolog 1; nucleoside diphosphate-linked moiety X motif 1; nucleoside diphosphate-linked moiety X-type motif 1; nudix (nucleoside diphosphate linked moiety X)-type motif 1; nudix motif 1; nudix hydrolase 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggcgcctccaggctctataccctggtgctggtcctgcagcctcagcgagttctcctgggcatgaaaaagcgaggcttcggggccggccggtggaatggctttgggggcaaagtgcaagaaggagagaccatcgaggatggggctaggagggagctgcaggaggagagcggtctgacagtggacgccctgcacaaggtgggccagatcgtgtttgagttcgtgggcgagcctgagctcatggacgtgcatgtcttctgcacagacagcatccaggggacccccgtggagagcgacgaaatgcgcccatgctggttccagctggatcagatccccttcaaggacatgtggcccgacgacagctactggtttccactcctgcttcagaagaagaaattccacgggtacttcaagttccagggtcaggacaccatcctggactacacactccgcgaggtggacacggtctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - COX19 cytochrome c oxidase assembly homolog (S. cerevisiae) - zinc finger, CCHC domain containing 9 - chromosome 16 open reading frame 74 - chromosome 14 open reading frame 79 |