Cart 8 Product Products 928,98 € (empty)
-
1 x PCMTD2-pro...113,40 € -
1 x NPFFR1-neu...121,50 € -
1 x THG1L-tRNA...121,50 € -
1 x CHST11-car...121,50 € -
1 x SNX8-sorti...121,50 € -
1 x ZNF511-zin...113,40 € -
-
1 x MRPL43-mit...113,40 €
No products
To be determined Shipping
928,98 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 8 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 928,98 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 928,98 €
Data sheet of KRTAP12-4-keratin associated protein 12-4 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about KRTAP12-4-keratin associated protein 12-4 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC125198 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KRTAP12-4 |
| Origin species: | Human |
| Product name: | KRTAP12-4-keratin associated protein 12-4 Gene |
| Size: | 2ug |
| Accessions: | BC125198 |
| Gene id: | 386684 |
| Gene description: | keratin associated protein 12-4 |
| Synonyms: | KRTAP12.4; keratin-associated protein 12-4; high sulfur keratin-associated protein 12.4; keratin associated protein 12-4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtgccacaccagccactcttcgggctgcccaatggcctgccctggctccccgtgctgtgtccccagcacctgctacccacccgagggctatgggacctcctgctgctgctcagccccctgtgtggctctgctgtgccggcccctgtgtggggtatccacctgctgccagccagcctgctgtgtgcccagcccctgccaggtggcctgctgtgtgcctgtgagctgcaagcctgttttgtgtgtggcttccttctgcccaacctctgggtgctgccagcccttctgccccaccctggtctatagacctgtcacctggagcacccccaccggctgctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - keratin associated protein 13-4 - keratin associated protein 12-1 - ribosomal protein S6 pseudogene - coiled-coil domain containing 88C |