C1orf31-chromosome 1 open reading frame 31 Gene View larger

C1orf31-chromosome 1 open reading frame 31 Gene

PTXBC116455

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C1orf31-chromosome 1 open reading frame 31 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C1orf31-chromosome 1 open reading frame 31 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC116455
Product type: DNA & cDNA
Ncbi symbol: C1orf31
Origin species: Human
Product name: C1orf31-chromosome 1 open reading frame 31 Gene
Size: 2ug
Accessions: BC116455
Gene id: 388753
Gene description: chromosome 1 open reading frame 31
Synonyms: C1orf31; CEMCOX4; cytochrome c oxidase assembly factor 6 homolog; cytochrome c oxidase assembly factor 6
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggcccgggaggtcccttactgtccccgagccgcgggttcctcttgtgcaaaacggggtggcactccaatcgcctgcttggtgattgtggcccccacacacctgtttctacagcgcttagcttcatcgcagtaggaatggcagccccatctatgaaggaaagacaggtctgctggggggcccgggatgagtactggaagtgtttagatgagaacttagaggatgcttctcaatgcaagaagttaagaagctctttcgaatcaagttgtccccaacagtggataaaatattttgataaaagaagagactacttaaaattcaaagaaaaatttgaagcaggacaatttgagccttcagaaacaactgcaaaatcctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 7 open reading frame 59
- secretoglobin, family 2A, member 2
- chromosome 1 open reading frame 88
- chromosome 3 open reading frame 60

Reviews

Buy C1orf31-chromosome 1 open reading frame 31 Gene now

Add to cart