Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of CCDC25-coiled-coil domain containing 25 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CCDC25-coiled-coil domain containing 25 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC032588 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CCDC25 |
| Origin species: | Human |
| Product name: | CCDC25-coiled-coil domain containing 25 Gene |
| Size: | 2ug |
| Accessions: | BC032588 |
| Gene id: | 55246 |
| Gene description: | coiled-coil domain containing 25 |
| Synonyms: | coiled-coil domain-containing protein 25; coiled-coil domain containing 25 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggactgtgcccaccttgtgaaggccaatagcattcaaggctgcaagatgaacaacgttaatgtggtatatacgccgtggtctaacctgaagaaaacagctgacatggatgtggggcagataggctttcacaggcagaaggatgtaaaaattgtgacagtggagaagaaagtaaatgagatcctgaaccgattagaaaagaccaaagtcgagcggttcccagacctagcagcagagaaagaatgcagagatcgtgaagagaggaatgagaaaaaagcccaaattcaggaaatgaaaaagagagaaaaagaagaaatgaagaagaagagggaaatggatgaacttaggagctattcatcactaatgaaagttgaaaatatgtcttcaaatcaggatggcaatgattcagatgaattcatgtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - keratin associated protein 4-2 - keratin associated protein 8-1 - ornithine decarboxylase antizyme 1 - hypothetical protein LOC150538 |