Cart 2 Product Products 230,97 € (empty)
-
1 x TECTB-tect...121,50 € -
No products
To be determined Shipping
230,97 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 2 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 230,97 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 230,97 €
View larger 
AFG3L1-AFG3 ATPase family gene 3-like 1 (S. cerevisiae) Gene
PTXBC045753
New product
Data sheet of AFG3L1-AFG3 ATPase family gene 3-like 1 (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about AFG3L1-AFG3 ATPase family gene 3-like 1 (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC045753 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | AFG3L1 |
| Origin species: | Human |
| Product name: | AFG3L1-AFG3 ATPase family gene 3-like 1 (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC045753 |
| Gene id: | 172 |
| Gene description: | AFG3 ATPase family gene 3-like 1 (S. cerevisiae) |
| Synonyms: | 1700047G05Rik; 3110061K15Rik; AFG3-like protein 1; AFG3(ATPase family gene 3)-like 1; AFG3-like AAA ATPase 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctgagtctggaggagacggaggcaggagaggagggaagcaggataacgttgcctggtggaggcggatgcagaaggggggacttcccctgggatgacgaggatttccgcagtctggcccttttgggggcaggcgttgccatgggatttttctacctctattttcgagatcctggaagagaaatcacgtggaagcactttgtacagtattacctggccagaggtctggtggaccggctggaagtcgtgaacaaacaatctgtgcgtgttattcctgcccctgggacctcttctgaagtgaggggtgaatttaaggctgagtattgcagacataagtttatttcgtgtaaaaatgtagttttctatttttttcagtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ectonucleoside triphosphate diphosphohydrolase 5 - heterogeneous nuclear ribonucleoprotein H2 (H') - X antigen family, member 1A - ribosomal protein, large, P1 |