Cart 1 Product Products 113,40 € (empty)
-
1 x ZNF616-zin...113,40 €
No products
To be determined Shipping
113,40 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 113,40 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 113,40 €
Data sheet of MRPL47-mitochondrial ribosomal protein L47 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MRPL47-mitochondrial ribosomal protein L47 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC021575 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MRPL47 |
| Origin species: | Human |
| Product name: | MRPL47-mitochondrial ribosomal protein L47 Gene |
| Size: | 2ug |
| Accessions: | BC021575 |
| Gene id: | 57129 |
| Gene description: | mitochondrial ribosomal protein L47 |
| Synonyms: | CGI-204; L47mt; MRP-L47; NCM1; 39S ribosomal protein L47, mitochondrial; nasopharyngeal carcinoma metastasis-related 1; nasopharyngeal carcinoma metastasis-related protein 1; mitochondrial ribosomal protein L47 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcttctaaccctagagcaggaggccaagcggcagagattgccaatgccaagtccagagcggttagataaggtagtagattccatggatgcattagataaagttgtccaggaaagagaagatgccctaaggcttcttcagactggtcaagaaagagctagacctggtgcttggagaagagacatctttggaagaatcatctggcacaagttcaagcagtgggttataccttggcacctaaataaaagatacaataggaaacgattctttgccttgccttatgtggaccattttctcagactggaacgtgagaaacgagcccgcatcaaagcacggaaggaaaatttagagagaaagaaagcaaaaattcttttaaaaaagtttccacatcttgctgaagcccaaaagtcaagtcttgtctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - zinc finger protein 702 pseudogene - chromosome 2 open reading frame 83 - chromosome 1 open reading frame 31 - chromosome 7 open reading frame 59 |