PTXBC031088
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC031088 |
Product type: | DNA & cDNA |
Ncbi symbol: | MYADML |
Origin species: | Human |
Product name: | MYADML-myeloid-associated differentiation marker-like Gene |
Size: | 2ug |
Accessions: | BC031088 |
Gene id: | 151325 |
Gene description: | myeloid-associated differentiation marker-like |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atgaccctggtcatcctcctcgtggagctgggcggctcccaggcccgcttccccttgttttggcgcaacttccccatcacctttgcctgctatgcggccctcttgtgcctctcggcctccatcatctaccccaccacctacttgcagttcctgtcccacggccgttcccgcgaccacgccatcgccgccatcgtcttctctggcatcgcctgtgtggcttatgccaccgaagtaacctggacccgggcccggcccggcgagatcactgactacatggcctccgagctggggctgctgaaggtgctggagaccttcgtggcctgcctcatcttcgtgttcatcaatagcccctacgtgtaccacaaccggccggccctggagtggtgcgtggcggtgtacgccctctgcttcgtcctggcggccctcactgtcctgctgagcctggggcactgcaccaacatgctgcccatccgcttccccagtttcctgttggggctggccttgctgtccgtcctcctctatgccactgcccttgtcctctggcccctctaccagttcaacgagaagtatggtgtccagccctggcagacgagagatgtgagctgcagcgacagaaacccctaccttgtgtgtatctgggaccgccgactggctgtgaccaacctgacggccgtcaacttgctggcctatgtgggcgacctggtgtactctgcccacctggtttttgtcaaggtctaa |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - TGFB-induced factor homeobox 2-like, Y-linked - family with sequence similarity 153, member C - family with sequence similarity 182, member A - family with sequence similarity 101, member A |