> >>ASCL4-achaete-scute complex homolog 4 (Drosophila) Gene
ASCL4-achaete-scute complex homolog 4 (Drosophila) Gene View larger

ASCL4-achaete-scute complex homolog 4 (Drosophila) Gene

PTXBC128211

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of ASCL4-achaete-scute complex homolog 4 (Drosophila) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ASCL4-achaete-scute complex homolog 4 (Drosophila) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC128211
Product type: DNA & cDNA
Ncbi symbol: ASCL4
Origin species: Human
Product name: ASCL4-achaete-scute complex homolog 4 (Drosophila) Gene
Size: 2ug
Accessions: BC128211
Gene id: 121549
Gene description: achaete-scute complex homolog 4 (Drosophila)
Synonyms: class II bHLH protein ASCL4; HASH4; bHLHa44; achaete-scute homolog 4; ASH-4; achaete-scute complex homolog 4; achaete-scute complex-like 4; achaete-scute-like protein 4; class A basic helix-loop-helix protein 44; achaete-scute family bHLH transcription factor 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagacgcgtaaaccggcggaacggctggccttgccatactcgctgcgcaccgcgcccctgggcgttccggggaccctgcccggactcccgcggagggaccccctcagggtcgccctgcgtctggacgccgcgtgctgggagtgggcgcgcagcggctgcgcacggggatggcagtacttgcccgtgccgctggacagcgccttcgagcccgccttcctccgcaagcgcaacgagcgcgagcggcagcgggtgcgctgcgtgaacgagggctatgcgcgcctccgagaccacctgccccgggagctggcagacaagcgcctcagcaaagtggagacgctccgcgctgccatcgactacatcaagcacctgcaggagctgctggagcgccaggcctgggggctcgagggcgcggccggcgccgtcccccagcgcagggcggaatgcaacagcgacggggagtccaaggcctcttcggcgccttcgcccagcagcgagcccgaggaggggggcagctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - similar to TBC1 domain family, member 2B
- arginine-rich, mutated in early stage tumors
- heterogeneous nuclear ribonucleoprotein A3
- ribosomal protein L27a

Reviews

Buy ASCL4-achaete-scute complex homolog 4 (Drosophila) Gene now

Add to cart