C12orf68-chromosome 12 open reading frame 68 Gene View larger

C12orf68-chromosome 12 open reading frame 68 Gene

PTXBC036801

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C12orf68-chromosome 12 open reading frame 68 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C12orf68-chromosome 12 open reading frame 68 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC036801
Product type: DNA & cDNA
Ncbi symbol: C12orf68
Origin species: Human
Product name: C12orf68-chromosome 12 open reading frame 68 Gene
Size: 2ug
Accessions: BC036801
Gene id: 387856
Gene description: chromosome 12 open reading frame 68
Synonyms: C12orf68; coiled-coil domain-containing protein 184; coiled-coil domain containing 184
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggacggtctgctggagatcatgaccaaggacggcggcgacatgccggcgcccctggaggtgtccaccgtgccggcagtgggggacgtgatctccggggagtacaacggcggcatgaaggaactgatggagcacctgaaagcccagctgcaagccctgtttgaggacgtgagggccatgaggggggccctggacgagcaggcctcgcacatccaggtgctctcggacgacgtgtgcgccaaccagcgagccatcgtctccatgtgccagattatgaccactgcgccccgccagggcggcttgggcgtggtcggcggcaaggggagcttccagagcgacccccaagagccggagactccttcgcctgggatcggggacagcggcttgctgggtcgcgatcccgaggacgaggaggacgaggaagaagagaaggagatgcccagccccgccacaccctccagtcactgtgagcgccccgaaagcccctgtgctggtctccttgggggggacgggccacttgtggagcccctcgatatgcccgacattaccctgctgcaactggagggcgaggcctccctgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 1 open reading frame 146
- chromosome 19 open reading frame 66
- chromosome 1 open reading frame 104
- hypothetical locus DKFZp434K191

Reviews

Buy C12orf68-chromosome 12 open reading frame 68 Gene now

Add to cart