Cart 2 Product Products 216,18 € (empty)
-
1 x C21orf49-c...113,40 € -
No products
To be determined Shipping
216,18 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 2 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 216,18 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 216,18 €
Data sheet of MGC3196-hypothetical protein MGC3196 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MGC3196-hypothetical protein MGC3196 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC127679 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MGC3196 |
| Origin species: | Human |
| Product name: | MGC3196-hypothetical protein MGC3196 Gene |
| Size: | 2ug |
| Accessions: | BC127679 |
| Gene id: | 79064 |
| Gene description: | hypothetical protein MGC3196 |
| Synonyms: | transmembrane protein 223 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggcgccttggaggcgatggcccacggggctgctagccgtgctgcggcccctgctcacctgccggcccctgcaaggcacgacgctgcaacgggatgtgctgctctttgagcatgatcggggccgcttcttcaccatcctcgggctgttctgcgcgggccagggcgtcttctgggcttccatggctgtggcagccgtgtcccggcccccggttccggtgcagcctctggatgcggaggtcccaaatcgtggccccttcgacctgcgctccgcgctctggcgctacggtctggccgtcggctgcggcgccatcggagccctcgtactcggtgctggtcttctcttctctctccggtctgtgcgctcagtggtgcttcgagctggagggcagcaggtgaccctcaccactcatgccccctttggcttgggggcccatttcacagttcctttgaagcaggtatcttgcatggcccaccggggtgaagtccctgccatgctacctctgaaagtcaaaggccgacgcttctatttcctcttggacaaaactggacacttccctaacacaaaactctttgacaatactgtgggtgcctaccggagcttgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - H2A histone family, member B1 - hypothetical locus MGC21881 - non-protein coding RNA 52 - non-protein coding RNA 86 |