Cart 4 Product Products 454,57 € (empty)
-
1 x HCFC1R1-ho...113,40 € -
1 x DDX19B-DEA...121,50 € -
1 x IFNG-inter...113,40 € -
No products
To be determined Shipping
454,57 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 4 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 454,57 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 454,57 €
View larger 
Data sheet of GSTM2-glutathione S-transferase mu 2 (muscle) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GSTM2-glutathione S-transferase mu 2 (muscle) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC110380 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GSTM2 |
| Origin species: | Human |
| Product name: | GSTM2-glutathione S-transferase mu 2 (muscle) Gene |
| Size: | 2ug |
| Accessions: | BC110380 |
| Gene id: | 2946 |
| Gene description: | glutathione S-transferase mu 2 (muscle) |
| Synonyms: | GSTM2-2; GST4; GSTM; GTHMUS; glutathione S-transferase Mu 2; GST class-mu 2; GST, muscle; S-(hydroxyalkyl)glutathione lyase M2; glutathione S-alkyltransferase M2; glutathione S-aralkyltransferase M2; glutathione S-aryltransferase M2; glutathione S-transferase 4; glutathione S-transferase M1; glutathione S-transferase M2 (muscle); glutathione S-transferase mu 2 (muscle) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcccatgacactggggtactggaacatccgcgggctggcccattccatccgcctgctcctggaatacacagactcaagctacgaggaaaagaagtacacgatgggggacgctcctgattatgacagaagccagtggctgaatgaaaaattcaagctgggcctggactttcccaatctgccctacttgattgatgggactcacaagatcacccagagcaacgccatcctgcggtacattgcccgcaagcacaacctgtgcggggaatcagaaaaggagcagattcgcgaagacattttggagaaccagtttatggacagccgtatgcagctggccaaactctgctatgacccagattttgagaaactgaaaccagaatacctgcaggcactccctgaaatgctgaagctctactcacagtttctggggaagcagccatggtctcttggggacaagatcacctttgtggatttcatcgcttatgatgtccttgagagaaaccaagtatttgagcccagctgcctggatgccttcccaaacctgaaggacttcatctcccgatttgagggcttggagaagatctctgcctacatgaagtccagccgcttcctcccaagacctgtgttcacaaagatggctgtctggggcaacaagtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - GTP cyclohydrolase I feedback regulator - complement component 8, gamma polypeptide - rabphilin 3A-like (without C2 domains) - t-complex-associated-testis-expressed 3 |