TM4SF20-transmembrane 4 L six family member 20 Gene

View larger

TM4SF20-transmembrane 4 L six family member 20 Gene

Reference: PTXBC035754

Condition: New product

Print

Data sheet of TM4SF20-transmembrane 4 L six family member 20 Gene

Brand	ProteoGenix
Product type	DNA & cDNA
Origin species	Human

More info about TM4SF20-transmembrane 4 L six family member 20 Gene

Brand:	ProteoGenix
Proteogenix catalog:	PTXBC035754
Product type:	DNA & cDNA
Ncbi symbol:	TM4SF20
Origin species:	Human
Product name:	TM4SF20-transmembrane 4 L six family member 20 Gene
Size:	2ug
Accessions:	BC035754
Gene id:	79853
Gene description:	transmembrane 4 L six family member 20
Synonyms:	PRO994; SLI5; TCCE518; transmembrane 4 L6 family member 20; transmembrane 4 L six family member 20
Sequence primers:	Forward primer M13R (5'â†’3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â†’3'): TAATACGACTCACTATAGG
Orf sequence:	atgacctgctgcgaaggatggacatcctgcaatggattcagcctgctggttctactgctgttaggagtagttctcaatgtgatacctctaattgtcagcttagttgaggaagaccaattttctcaaaaccccatctcttgctttgagtggtggttcccaggaattataggagcaggtctgatggccattccagcaacaacaatgtccttgacagcaagaaaaagagcgtgctgcaacaacagaactggaatgtttctttcatcatttttcagtgtgatcacagtcattggtgctctgtattgcatgctgatatccatccaggctctcttaaaaggtcctctcatgtgtaattctccaagcaacagtaatgccaattgtgaattttcattgaaaaacatcagtgacattcatccagaatccttcaacttgcagtggtttttcaatgactcttgtgcacctcctactggtttcaataaacccaccagtaacgacaccatggcgagtggctggagagcatctagtttccacttcgattctgaagaaaacaaacataggcttatccacttctcagtatttttaggtctattgcttgttggaattctggaggtcctgtttgggctcagtcagatagtcatcggtttccttggctgtctgtgtggagtctctaagcgaagaagtcaaattgtgtag
Vector:	pDONR223
Delivery lead time in business days in europe:	10-12 days
Storage:	-20â„ƒ
Delivery condition:	Blue Ice
Related products:	- chromosome 21 open reading frame 129 - chromosome 21 open reading frame 125 - chromosome 10 open reading frame 125 - chromosome 14 open reading frame 105

Reviews

Be the first to write your review !

Buy TM4SF20-transmembrane 4 L six family member 20 Gene now