Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
FCGR3B-Fc fragment of IgG, low affinity IIIb, receptor (CD16b) Gene
PTXBC128562
New product
Data sheet of FCGR3B-Fc fragment of IgG, low affinity IIIb, receptor (CD16b) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FCGR3B-Fc fragment of IgG, low affinity IIIb, receptor (CD16b) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC128562 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FCGR3B |
| Origin species: | Human |
| Product name: | FCGR3B-Fc fragment of IgG, low affinity IIIb, receptor (CD16b) Gene |
| Size: | 2ug |
| Accessions: | BC128562 |
| Gene id: | 2215 |
| Gene description: | Fc fragment of IgG, low affinity IIIb, receptor (CD16b) |
| Synonyms: | CD16; CD16b; FCG3; FCGR3; FCR-10; FCRIII; FCRIIIb; low affinity immunoglobulin gamma Fc region receptor III-B; Fc fragment of IgG, low affinity IIIb, receptor (CD16b); Fc gamma receptor IIIb; Fc-gamma receptor IIIb (CD 16); fc-gamma RIII-beta; fc-gamma RIIIb; igG Fc receptor III-1; Fc fragment of IgG receptor IIIb |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtggcagctgctcctcccaactgctctgctacttctagtttcagctggcatgcggactgaagatctcccaaaggctgtggtgttcctggagcctcaatggtacagcgtgcttgagaaggacagtgtgactctgaagtgccagggagcctactcccctgaggacaattccacacagtggtttcacaatgagagcctcatctcaagccaggcctcgagctacttcattgacgctgccacagtcaacgacagtggagagtacaggtgccagacaaacctctccaccctcagtgacccggtgcagctagaagtccatatcggctggctgttgctccaggcccctcggtgggtgttcaaggaggaagaccctattcacctgaggtgtcacagctggaagaacactgctctgcataaggtcacatatttacagaatggcaaagacaggaagtattttcatcataattctgacttccacattccaaaagccacactcaaagatagcggctcctacttctgcagggggcttgttgggagtaaaaatgtgtcttcagagactgtgaacatcaccatcactcaaggtttggcagtgtcaaccatctcatcattctctccacctgggtaccaagtctctttctgcttggtgatggtactcctttttgcagtggacacaggactatatttctctgtgaagacaaacatttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - RNA (guanine-9-) methyltransferase domain containing 3 - splA/ryanodine receptor domain and SOCS box containing 3 - cytochrome P450, family 21, subfamily A, polypeptide 2 - cytochrome c oxidase subunit VIIa polypeptide 2 (liver) |