Cart 36 Product Products 4 533,94 € (empty)
-
-
-
-
-
1 x APBB2-amyl...121,50 € -
1 x APOBEC3F-a...121,50 € -
1 x CCL7-chemo...113,40 € -
1 x IFNA1-inte...113,40 € -
-
1 x OBFC1-olig...121,50 € -
1 x ANKRA2-ank...121,50 € -
1 x AP3S1-adap...113,40 € -
-
1 x OCIAD1-OCI...113,40 € -
-
-
1 x TRAIL494,00 € -
1 x HIGD1B-HIG...113,40 € -
1 x IDI2-isope...113,40 € -
1 x HCG27-HLA...113,40 € -
-
-
1 x AMDHD1-ami...121,50 € -
-
-
-
1 x CCRL1-chem...121,50 € -
1 x IFIH1-inte...113,40 € -
-
1 x SETD3-SET...121,50 € -
1 x FANCF-Fanc...121,50 € -
-
-
-
-
No products
To be determined Shipping
4 533,94 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 36 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 4 533,94 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 4 533,94 €
View larger 
Data sheet of TPPP-tubulin polymerization promoting protein Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TPPP-tubulin polymerization promoting protein Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC131506 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TPPP |
| Origin species: | Human |
| Product name: | TPPP-tubulin polymerization promoting protein Gene |
| Size: | 2ug |
| Accessions: | BC131506 |
| Gene id: | 11076 |
| Gene description: | tubulin polymerization promoting protein |
| Synonyms: | TPPP/p25; TPPP1; p24; p25; p25alpha; tubulin polymerization-promoting protein; 25 kDa brain-specific protein; brain specific protein p25 alpha; glycogen synthase kinase 3 (GSK3) inhibitor p24; p25-alpha; tubulin polymerization promoting protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctgacaaggccaagcctgccaaagctgccaacaggacgccccccaagtccccgggggacccctcgaaggaccgggcagccaagaggctgtcgctggaatcggagggtgctggtgagggggcagccgcatcccctgagctcagtgccctggaggaggccttccggcgctttgccgtgcacggggacgccagggccaccgggagggagatgcacggcaagaactggtcgaagctgtgcaaggactgccaggtgatcgacggcaggaacgtgaccgtcactgacgtggacatcgtcttcagcaagatcaaagggaagtcttgccggaccatcacctttgagcagttccaggaggcgctggaggagctcgccaagaagcgattcaaagacaagagcagcgaggaggccgttcgcgaggtgcacaggctcatcgagggcaaggcgcccatcatctcaggggtgacgaaagccatctcgtcgcccacagtgtcgaggctcacggacaccaccaagttcacgggctcccacaaggagcgcttcgacccctctggcaagggcaagggcaaggctggccgcgtggatctggtggacgagtcaggctatgtgtccggctacaagcacgcaggcacctacgaccagaaggtgcaagggggcaagtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - similar to ankyrin repeat domain 20A - glutathione S-transferase mu 2 (muscle) - GTP cyclohydrolase I feedback regulator - complement component 8, gamma polypeptide |