> >>RTP3-receptor (chemosensory) transporter protein 3 Gene
RTP3-receptor (chemosensory) transporter protein 3 Gene View larger

RTP3-receptor (chemosensory) transporter protein 3 Gene

PTXBC131756

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of RTP3-receptor (chemosensory) transporter protein 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RTP3-receptor (chemosensory) transporter protein 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC131756
Product type: DNA & cDNA
Ncbi symbol: RTP3
Origin species: Human
Product name: RTP3-receptor (chemosensory) transporter protein 3 Gene
Size: 2ug
Accessions: BC131756
Gene id: 83597
Gene description: receptor (chemosensory) transporter protein 3
Synonyms: LTM1; TMEM7; Z3CXXC3; receptor-transporting protein 3; 3CxxC-type zinc finger protein 3; receptor (chemosensory) transporter protein 3; transmembrane protein 7; zinc finger, 3CxxC-type 3; receptor transporter protein 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctggggacacagaagtgtggaagcaaatgtttcaggagttaatgcgggaggtgaagccatggcacaggtggaccctgagaccagacaagggccttcttcccaacgtcctgaagccaggctggatgcaataccagcagtggaccttcgccaggttccagtgctcctcctgctctcgtaactgggcctctgcccaagttctggtccttttccacatgaactggagtgaggagaagtccaggggccaggtgaagatgagggtgtttacccagagatgtaagaagtgcccccaacctctgtttgaggaccctgagttcacacaagagaacatctcaaggatcctgaaaaacctggtgttccgaattctgaagaaatgctatagaggaagatttcagttgatagaggaggttcctatgatcaaggacatctctcttgaagggccacacaatagtgacaactgtgaggcatgtctgcagggcttctgtgctgggcccatacaggttacaagcctccccccatctcagaccccaagagtacactccatttacaaggtggaggaggtagttaagccctgggcctcaggagagaatgtctattcctacgcatgccaaaaccacatctgtaggaacttaagcattttctgctgttgtgtcattctcattgttatcgtggtgattgttgtaaaaactgctatatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - achaete-scute complex homolog 4 (Drosophila)
- similar to TBC1 domain family, member 2B
- arginine-rich, mutated in early stage tumors
- heterogeneous nuclear ribonucleoprotein A3

Reviews

Buy RTP3-receptor (chemosensory) transporter protein 3 Gene now

Add to cart