Cart 22 Product Products 2 950,09 € (empty)
-
1 x RAB6A-RAB6...113,40 € -
1 x HDHD2-halo...113,40 € -
1 x IDI1-isope...113,40 € -
-
1 x AASDHPPT-a...121,50 € -
1 x OCM-oncomo...113,40 € -
1 x IFNA21-int...113,40 € -
1 x IFNB1-inte...113,40 € -
1 x ABHD14A...259,07 € -
-
1 x DDIT4L-DNA...113,40 € -
1 x APLN-apeli...113,40 € -
1 x UBE2V1-ubi...113,40 € -
-
1 x ST3GAL3-ST...121,50 € -
-
1 x RAC2-ras-r...113,40 € -
-
1 x LDOC1-leuc...113,40 € -
1 x APOBEC3B-a...113,40 € -
1 x HEPACAM-he...121,50 € -
No products
To be determined Shipping
2 950,09 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 22 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 2 950,09 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 2 950,09 €
View larger 
MPP3-membrane protein, palmitoylated 3 (MAGUK p55 subfamily member 3) Gene
PTXBC025743
New product
Data sheet of MPP3-membrane protein, palmitoylated 3 (MAGUK p55 subfamily member 3) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MPP3-membrane protein, palmitoylated 3 (MAGUK p55 subfamily member 3) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC025743 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MPP3 |
| Origin species: | Human |
| Product name: | MPP3-membrane protein, palmitoylated 3 (MAGUK p55 subfamily member 3) Gene |
| Size: | 2ug |
| Accessions: | BC025743 |
| Gene id: | 4356 |
| Gene description: | membrane protein, palmitoylated 3 (MAGUK p55 subfamily member 3) |
| Synonyms: | DLG3; MAGUK p55 subfamily member 3; discs, large homolog 3; membrane protein palmitoylated 3; membrane protein, palmitoylated 3 (MAGUK p55 subfamily member 3); membrane palmitoylated protein 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccagtgctatcggaggactctggtttgcatgaaaccctggccctgctgacctcccagctcagacctgactccaaccacaaggaggagatgggcttcctgagggatgttttcagtgaaaaaagcctcagttacttaatgaagattcatgagaagcttcgctattatgaaaggcaaagtccaaccccagttctgcacagcgctgtggccctcgctgaggacgtgatggaggagttgcaggccgcctccgtgcacagtgatgagagggagctgctccagctgctgtccaccccgcacctgagggctgtgctcatggtacatgacacggttgcccagaagaattttgaccccgttctcccgcctctgcctgacgatatcgatgaggattttgatgaggaatcggtgaagatcgtccgcttggtgaagaacaaggaacccctgggtgccaccatccggcgggacgagcactcaggggctgttgtggtggccaggatcatgcgaggaggcgcagcagacaggagcggcctggtccacgttggagatgagctccgagaagtgaacgggatcgcagtcctgcacaagcggcccgacgagatcagccagattctggcccagtcccagggatccatcaccctaaaaatcatcccagccacccaggaggaagatcgcttaaaggagagcaaggtgttcatgcgcgccctcttccactacaaccctcgggaggaccgggccatcccttgccaggaggcgggcctgcccttccagcgcaggcaggtcctggagggcaggcctgcgctggaagggcaggcaggtcctggaggtggtgagccaggacgaccccacgtggtggcaggccaagcgagtcggggacaccaaccttcgagccggcctcatcccctccaaggggttccaggagagacgactaagctaccggagagccgcgggcaccctgccgagcccccagagcctcaggaagcccccctagacctgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - N-acetylneuraminate pyruvate lyase (dihydrodipicolinate synthase) - fibronectin type III domain containing 3B - cysteine conjugate-beta lyase, cytoplasmic - ATPase, H+/K+ exchanging, beta polypeptide |