Cart 12 Product Products 1 740,24 € (empty)
-
1 x CLEC7A-C-t...113,40 € -
1 x CNOT8-CCR4...121,50 € -
-
-
1 x SH2D1B-SH2...113,40 € -
1 x TMOD2-trop...121,50 € -
1 x ANAPC13-an...113,40 € -
1 x TMEM60-tra...113,40 € -
1 x TBX10-T-bo...121,50 € -
1 x Phospho-In...259,07 € -
-
No products
To be determined Shipping
1 740,24 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 12 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 740,24 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 740,24 €
View larger 
RRH-retinal pigment epithelium-derived rhodopsin homolog Gene
PTXBC128120
New product
Data sheet of RRH-retinal pigment epithelium-derived rhodopsin homolog Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RRH-retinal pigment epithelium-derived rhodopsin homolog Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC128120 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RRH |
| Origin species: | Human |
| Product name: | RRH-retinal pigment epithelium-derived rhodopsin homolog Gene |
| Size: | 2ug |
| Accessions: | BC128120 |
| Gene id: | 10692 |
| Gene description: | retinal pigment epithelium-derived rhodopsin homolog |
| Synonyms: | visual pigment-like receptor peropsin; retinal pigment epithelium-derived rhodopsin homolog |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctaagaaataatttaggcaacagttcagactctaaaaatgaagatggctcggtcttttcacagactgaacacaatattgttgcaacttacttgattatggcaggtatgataagtattatcagcaacataatagttctgggcatcttcattaagtacaaggaacttcggacacccacaaatgcaattattattaacctggctgttactgatataggggtcagtagcattggctatcccatgtctgctgcctcagatctgtatggaagttggaaatttggatacgcaggctgtcaggtttatgctggattgaatattttttttggaatggcaagcattggattactcacggtcgtggctgtggaccgatacctgaccatctgccttcctgacgtagggagaagaatgaccaccaacacttacatcggcttgattctgggagcctggatcaatggcctgttttgggctttgatgcctatcatagggtgggctagttatgccccagatcctactggtgctacgtgtaccataaactggaggaaaaatgatagatcttttgtgtcttacaccatgacagttattgcgataaattttattgtgcccttgacagtgatgttttactgctattaccatgtcacgctatccattaaacatcacactaccagtgactgcactgagtccctcaacagagactggtcagatcagatagatgtaacaaagatgtctgtgatcatgatctgcatgtttctggtggcatggtccccttattccatcgtgtgcttatgggcttcttttggtgacccaaagaagattcctccccccatggccatcatagctccactgtttgcaaaatcttctacattctataacccctgcatttatgtggttgctaataaaaagtttcggagggcaatgcttgccatgttcaaatgtcagactcaccaaacaatgcctgtgacaagtattttacccatggatgtatctcaaaacccattggcttctggaagaatctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - golgi autoantigen, golgin subfamily a, 2-like 1 - ATPase, (Na+)/K+ transporting, beta 4 polypeptide - chemokine (C-C motif) ligand 5 - chemokine (C-C motif) ligand 2 |