Cart 14 Product Products 1 652,40 € (empty)
-
1 x TXNDC11-th...121,50 € -
1 x KCTD18-pot...121,50 € -
1 x LIMD2-LIM...113,40 € -
1 x RBM11-RNA...121,50 € -
1 x PSMA2-prot...113,40 € -
1 x CCDC21-coi...113,40 € -
1 x C11orf57-c...113,40 € -
1 x C19orf50-c...113,40 € -
1 x GABPB1-GA...121,50 € -
1 x PRPS2-phos...121,50 € -
1 x NUP37-nucl...121,50 € -
1 x C1orf128-c...113,40 € -
1 x UBAC1-UBA...121,50 € -
1 x SLC35B4-so...121,50 €
No products
To be determined Shipping
1 652,40 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 14 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 652,40 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 652,40 €
Data sheet of TMEM72-transmembrane protein 72 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TMEM72-transmembrane protein 72 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC127790 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TMEM72 |
| Origin species: | Human |
| Product name: | TMEM72-transmembrane protein 72 Gene |
| Size: | 2ug |
| Accessions: | BC127790 |
| Gene id: | 643236 |
| Gene description: | transmembrane protein 72 |
| Synonyms: | C10orf127; KSP37; transmembrane protein 72; kidney-specific secretory protein of 37 kDa |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcagctccaggtgttctggactgggctggaatacacctgccggctcctgggcatcaccactgctgcagtgttgatcggcgtgggcactgagaccttcctccagggccagttcaaaagcctggctttctatctgctgtttacaggagccgctgtctccatatgtgaaggggcctactttgtggctcagctgctggccatctgcttccagtgtcaaccagggtccctggcagacagagtaagggagaaagcccactggctgggctgcttccagaagttcctggcctacctgctgctgtcggtggcctgcttcctccacccggtcctggtctggcacgtgaccatcccaggctccatgctcatcatcaccggcctggcctacttccttctgagcaagcggaagaagaggaaagctgcccccgaggtgctggcctccccagagcagtacacagacccctctagcagcgctgtgagcaccaccggctctggggacacagagcaaacctacactttccatggggccctcaaggaggggcccagctcccttttcatccacatgaagagtatcctgaaggggactaagaagcccagtgccctccagccccccaacaccctgatggagctgagcctggagccagccgactccctggccaagaagaagcaggtgcactttgaagacaacttggtccgcatagtcccctccctcgctgaaggtctggatgatggggacagtgagccagaggagaccacctctgacacgacacccatcattccccctccccaggccccactcttcctgtcatctcttacagccaccggcctgttctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - transmembrane protein 82 - testis serine protease 5 - similar to CG14853-PB - hypothetical LOC388182 |