Cart 2 Product Products 234,90 € (empty)
-
1 x MPST-merca...113,40 € -
1 x TPH1-trypt...121,50 €
No products
To be determined Shipping
234,90 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 2 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 234,90 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 234,90 €
Data sheet of KIAA0574-KIAA0574 protein Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about KIAA0574-KIAA0574 protein Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC127817 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KIAA0574 |
| Origin species: | Human |
| Product name: | KIAA0574-KIAA0574 protein Gene |
| Size: | 2ug |
| Accessions: | BC127817 |
| Gene id: | 23359 |
| Gene description: | KIAA0574 protein |
| Synonyms: | TMEM228; protein FAM189A1; transmembrane protein 228; family with sequence similarity 189 member A1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtgctgtatgcagatggtctcctccgatgtcctgcagatgttccttccgcagaggtcacatcctgccaaccccacctgcgtgactcctcacggcaccgttctccaccagaccctggatttcgacgagttcatccccccactcccgcctccaccctattaccccccagagtacacctgcacaccgtccactgaggcccagaggggcctccacctggactttgctccgtctccattcggcactttgtatgacgtggccatcaatagccccggcctgctctatcctgctgagctcccccctccgtacgaggcggtggtgggccagccccctgccagccaggttacaagtataggtcagcaggtggccgagtccagctccggggacccaaacaccagtgctggcttcagcactccagtaccagctgacagcacaagcctcctggtgtccgagggcactgctacgccaggttccagcccatcccccgatggccctgtgggcgccccagcaccctccgaacctgcccttcccctggccgcgtgtctccagaggatcctggcatgggctcacaggtgcagccaggtcccgggcatgtgtcccgctccaccagcgaccccaccttgtgcacatctagcatggcaggcgatgcctcttcacacaggccgtcgtgtagccaggacctggaagcgggactgtctgaggctgtgcctgggagcgcttccatgtctcgctctgccacggctgcctgtcgggcccagctttcaccagcgggggacccagatacctggaaaactgaccaacggccaacaccagagcccttcccagcgacctccaaagagcggccacgctctttag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - FLJ45422 protein - Bcl2 modifying factor - FLJ35767 protein - KIAA1486 protein |