Cart 36 Product Products 5 973,77 € (empty)
-
-
1 x ZBP1-Z-DNA...113,40 € -
-
1 x Prolactin-...744,00 € -
1 x RSPO3-R-sp...121,50 € -
1 x Prolactin324,00 € -
1 x MAPKAP1-mi...121,50 € -
1 x RAB40AL-RA...121,50 € -
1 x C20orf141-...113,40 € -
1 x CABYR-calc...121,50 € -
1 x NXNL2-nucl...113,40 € -
-
1 x PAX3-paire...121,50 € -
-
1 x CSF2-colon...113,40 € -
1 x SLC35E2-so...121,50 € -
-
-
1 x DKKL1-dick...113,40 € -
-
1 x HM13-histo...121,50 € -
1 x FBXO39-F-b...121,50 € -
1 x SIN3A-SIN3...113,40 € -
1 x Olfactory...259,07 € -
1 x RNF11-ring...113,40 € -
1 x CPI-17...259,07 € -
1 x RSPO1-R-sp...113,40 € -
-
-
-
1 x LRRC3-leuc...113,40 € -
1 x Phospho-Lc...259,07 € -
-
-
1 x MGC34761-h...121,50 € -
1 x RPS27A-rib...113,40 €
No products
To be determined Shipping
5 973,77 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 36 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 5 973,77 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 5 973,77 €
Data sheet of AHCY-S-adenosylhomocysteine hydrolase Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about AHCY-S-adenosylhomocysteine hydrolase Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC114924 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | AHCY |
| Origin species: | Human |
| Product name: | AHCY-S-adenosylhomocysteine hydrolase Gene |
| Size: | 2ug |
| Accessions: | BC114924 |
| Gene id: | 191 |
| Gene description: | S-adenosylhomocysteine hydrolase |
| Synonyms: | SAHH; adoHcyase; adenosylhomocysteinase; S-adenosyl-L-homocysteine hydrolase; S-adenosylhomocysteine hydrolase |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgattctggacgacgggggcgacctcaccaacctcatccacaccaagtacccgcagcttctgccaggcatccgaggcatctctgaggagaccacgactggggtccacaacctctacaagatgatggccaatgggatcctcaaggtgcctgccatcaatgtcaatgactccgtcaccaagagcaagtttgacaacctctatggctgccgggagtccctcatagatggcatcaagcgggccacagatgtgatgattgccggcaaggtagcggtggtagcaggctatggtgatgtgggcaagggctgtgcccaggccctgcggggtttcggagcccgcgtcatcatcaccgagattgaccccatcaacgcactgcaggctgccatggagggctatgaggtgaccaccatggatgaggcctgtcaggagggcaacatctttgtcaccaccacaggctgtattgacatcatccttggccggcactttgagcagatgaaggatgatgccattgtgtgtaacattggacactttgacgtggagatcgatgtcaagtggctcaacgagaacgccgtggagaaggtgaacatcaagccgcaggtggaccggtatcggttgaagaatgggcgccgcatcatcctgctggccgagggtcggctggtcaacctgggttgtgccatgggccaccccagcttcgtgatgagtaactccttcaccaaccaggtgatggcgcagatcgagctgtggacccatccagacaagtaccccgttggggttcatttcctgcccaagaagctggatgaggcagtggctgaagcccacctgggcaagctgaatgtgaagttgaccaagctaactgagaagcaagcccagtacctgggcatgtcctgtgatggccccttcaagccggatcactaccgctactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - protease, serine, 1 (trypsin 1) - ADP-ribosylation factor-like 4C - spermatogenesis associated 12 - synovial sarcoma, X breakpoint 1 |