Cart 6 Product Products 697,57 € (empty)
-
1 x ZNF70-zinc...121,50 € -
1 x C14orf79-c...113,40 € -
1 x EGR3-early...121,50 € -
1 x RP11-265F1...121,50 € -
-
1 x TPD52-tumo...113,40 €
No products
To be determined Shipping
697,57 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 6 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 697,57 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 697,57 €
Data sheet of KRTAP10-9-keratin associated protein 10-9 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about KRTAP10-9-keratin associated protein 10-9 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC131613 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KRTAP10-9 |
| Origin species: | Human |
| Product name: | KRTAP10-9-keratin associated protein 10-9 Gene |
| Size: | 2ug |
| Accessions: | BC131613 |
| Gene id: | 386676 |
| Gene description: | keratin associated protein 10-9 |
| Synonyms: | KAP10.9; KAP18.9; KRTAP18-9; keratin-associated protein 10-9; high sulfur keratin-associated protein 10.9; keratin associated protein 18-9; keratin-associated protein 10.9; keratin-associated protein 18.9; keratin associated protein 10-9 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccgcgtccaccatgtccatccgctccagcgcttactccgactcctggcaggtggacgactgcccagagagctgctgtgagcccccctgctgcgccaccagctgctgcgccccggccccctgcctgaccctggtctgcaccccagtgagccgtgtatccagcccctgctgccaggtgacctgtgagcccagcccctgccaatcaggctgcaccagctcctgcacgccctcgtgctgccagcagtctagctgccagccggcttactgcacctcctccccctgccagcaggcctgctgcgtgcccgtctgctgcaagcctgtgtgctgtgtgcccgtctgctgtggggcttcttcgtgctgccaacagtctagctaccagccagcttgctgtgcctcttcctcctgccagccggcctgctgtgtgcccgtctgctgcaaacctgtgtgctgtgcgcccacctgctctgaggattcctattcatgctgccaacagtctagctgccagccagcttgctgcacttcctccccctgccagcagtcctgctgtgtgcctgtctgctgtaagcctgtctgctgcaaacccatctgctgtgtgcctgtctgctctggggcttcctctctgtgctgccagcagtctggctgccagccggcttgctgcaccacctcctgctgcagaccctcctcctctgtgtccctcctctgccgccctgtgtgcaggcccgcctgctgcgtgcccgtctcctcctgctgtgcccccacctcctcctgccagcccagctattgccgccaggcctcctgtgtgtcccttctctgccgccctgtgtgctcccgccctgcctgctacagcttctcctcaggccagaagtccagctgctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - prolactin regulatory element binding - taste receptor, type 2, member 42 - lipoma HMGIC fusion partner-like 3 - lipoma HMGIC fusion partner-like 3 |