Cart 5 Product Products 572,58 € (empty)
-
1 x C13orf3-ch...121,50 € -
1 x HIST4H4-hi...113,40 € -
1 x POU5F2-POU...121,50 € -
-
1 x COX7C-cyto...113,40 €
No products
To be determined Shipping
572,58 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 5 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 572,58 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 572,58 €
Data sheet of ZNF409-zinc finger protein 409 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ZNF409-zinc finger protein 409 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC131533 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ZNF409 |
| Origin species: | Human |
| Product name: | ZNF409-zinc finger protein 409 Gene |
| Size: | 2ug |
| Accessions: | BC131533 |
| Gene id: | 22830 |
| Gene description: | zinc finger protein 409 |
| Synonyms: | ZNF409; ZFH-5; zinc finger homeobox protein 2; ZFH-2; zinc finger homeodomain protein 2; zinc finger protein 409; zinc finger homeobox 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccacccttaactcagcctctaccactggtaccaccccctcccctgggcacaatgccccgtccctgccttcggacaccttctcctccagcaccccctctgatcctgtcaccaaagatccccctgctgcctcctccacctctgagaacatgaggtcctcagagccagggggacagctcctggagtcgggctgtggcctcgtcccaccaaaggagattggggagccccaggaagggcctgactgtggtcacttcccaccaaatgacccaggggtggaaaaggacaaggagcaggaggaggaagaagaagggctccctcccatggacctaagcaaccacttattcttcacagctggaggtgaggcctacctagtggccaagctgtccctgccaggtggcagtgaactcctgttaccaaagggcttcccctggggtgaggcgggcatcaaggaagagcccagtctgcccttccttgcctacccacccccctcacacctcactgcccttcacatccaacatggctttgacccaatccaaggctttagctcttctgaccaaattctgtcccatgatacctcagcaccatctccggctgcctgtgaggaaaggcatggagctttctggagctaccagctggctccaaatccacccggagatcccaaagatggccccatggggaacagcgggggcaaccacgtggcggtcttctggctctgccttctgtgccgcctgggtttcagcaagccccaggcctttatggatcacacacagtctcatggggtgaagctaacccctgcccaatatcagggcctgtcaggtagcccagctgtactccaggagggagatgaaggctgcaaggccctcataagctttctggagccaaaactccctgctcgcccctcttctgacataccccttgacaacagcagcacagtgaacatggaggcgaatgtggcccagacagaggatggcccccctgaggcagaagtccaggcccttatcctcctggatgaagaagttatggccctcagcccaccctctccacccacagccacctggggctataccactgcctgttgtgtgcgtgggagacaccctcccgcttggctgtgctgcaacacctgcgcacacctgcccaccgcgatgcccaggcccagaggcgtctgcagctgctacagaatggcccaaccactgaggaaggactcgcagctcttcagagcatcctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - fat-inducing transcript 1 - leucine zipper protein 2 - thioredoxin reductase 2 - leucine zipper protein 4 |