Cart 10 Product Products 1 161,11 € (empty)
-
1 x TSSC4-tumo...121,50 € -
1 x ZC3H7A-zin...113,40 € -
1 x AKR7A2-ald...121,50 € -
-
1 x EBAG9-estr...113,40 € -
1 x CHST4-carb...121,50 € -
1 x MYL6-myosi...113,40 € -
1 x MUSTN1-mus...113,40 € -
1 x RASGEF1B-R...121,50 € -
No products
To be determined Shipping
1 161,11 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 10 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 161,11 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 161,11 €
Data sheet of AKAP5-A kinase (PRKA) anchor protein 5 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about AKAP5-A kinase (PRKA) anchor protein 5 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC131516 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | AKAP5 |
| Origin species: | Human |
| Product name: | AKAP5-A kinase (PRKA) anchor protein 5 Gene |
| Size: | 2ug |
| Accessions: | BC131516 |
| Gene id: | 9495 |
| Gene description: | A kinase (PRKA) anchor protein 5 |
| Synonyms: | AKAP75; H21; A-kinase anchor protein 5; A kinase (PRKA) anchor protein 5; A-kinase anchor protein 79 kDa; A-kinase anchoring protein 75/79; AKAP 79; cAMP-dependent protein kinase regulatory subunit II high affinity-binding protein; A-kinase anchoring protein 5 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaaaccacaatttcagaaattcatgtagaaaacaaggatgagaagagatcagcagaaggtagtcctggggctgaaaggcagaaggaaaaggcatccatgctttgcttcaagagaagaaagaaagcagccaaagcactgaagcccaaagctggctctgaagctgctgatgtggcaaggaagtgtccacaagaagcaggagcttctgatcagccagagcccacacggggggcctgggcctcactcaaacgtcttgtaacacgcaggaaaaggtcagagtcttcaaagcagcaaaagccattggagggtgaaatgcaacctgcaataaatgctgaggatgctgatctttctaagaaaaaggcaaaatctagacttaagattccctgcataaaattcccaagagggccaaaaaggagtaatcattccaaaattatagaagactcagactgcagcatcaaagtccaggaagaagctgaaattttggatatacaaacacagaccccattgaatgatcaggcaacaaaggctaagtcaacccaggatctaagtgaaggcatctcacggaaagatggtgatgaggtctgtgaatcaaatgtgagcaatagcataacttctggagagaaagtgatttcagtagaacttggattagataatgggcattctgctattcaaacgggaactctaatccttgaagaaattgaaacgatcaaggaaaaacaagatgttcaaccccagcaagcaagcccacttgaaacttcagaaacagaccatcagcagccagtactttctgatgttcctcctttacctgcaattccagatcaacaaattgtggaagaagccagtaacagtaccctagaaagtgcaccaaatggaaaagactatgaaagtacagagattgtagctgaagaaactaagccaaaagatactgaattgagccaagaatcagattttaaagaaaatgggatcactgaagagaaatccaaatcagaagaaagcaaaagaatggagccaattgctattattattacagacactgaaatcagtgaatttgatgttacaaaatctaaaaatgtccctaagcaattcttaatttcagctgaaaatgagcaagtaggggtttttgctaatgataatggttttgaggatagaacttcagaacaatatgaaacactcttaattgaaacagcctcttctctagtcaagaatgctattcagttgtcaatagaacagctggttaatgaaatggcctctgatgataataaaataaacaatcttctacagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - hypothetical protein FLJ36144 - thioredoxin domain containing 1 - hypothetical protein LOC90835 - hypothetical protein FLJ10213 |