Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
RNPEPL1-arginyl aminopeptidase (aminopeptidase B)-like 1 Gene
PTXBC099906
New product
Data sheet of RNPEPL1-arginyl aminopeptidase (aminopeptidase B)-like 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RNPEPL1-arginyl aminopeptidase (aminopeptidase B)-like 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC099906 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RNPEPL1 |
| Origin species: | Human |
| Product name: | RNPEPL1-arginyl aminopeptidase (aminopeptidase B)-like 1 Gene |
| Size: | 2ug |
| Accessions: | BC099906 |
| Gene id: | 57140 |
| Gene description: | arginyl aminopeptidase (aminopeptidase B)-like 1 |
| Synonyms: | arginyl aminopeptidase-like 1; RNPEP-like 1; aminopeptidase B-like 1; argininyl aminopeptidase-like 1; arginyl aminopeptidase (aminopeptidase B)-like 1; arginyl aminopeptidase like 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcccagcgccgtatcaccaccgagacctacggtgcggccagggccggggagggcagccacggggggccctgggcactggtccaggggcagagagcctagcctggcccccctgccatgctgcaggtgcccacacctcctgcttcccccgacgacccctacaccccctcacctctcctctgtctccggaccccatccaggtgctgccttcacctgcctggagactgccttccgcctggacgccctgcaccggcagatgaagcttctgggagaggacagcccggtcagcaaactgcaggtcaagctggagccaggagtgaatcccagccacctgatgaacctgttcacctacgagaagggctactgcttcgtgtactacctgtcccagctctgcggagacccacagcgctttgatgactttctccgagcctatgtggagaagtacaagttcaccagcgtggtggcccaggacctgctggactccttcctgagcttcttcccggagctgaaggagcagagcgtggactgccgggcagggctggaattcgagcgctggctcaatgccacaggcccgccgctggctgagccggacctgtctcagggatccagcctgacccggcacgtggaggcccttttccagctgtggaccgcagaacctctggaccaggcagctgcctcggccagcgccattgacatctccaagtggaggaccttccagacagcactcttcctggaccggctcctggatgggtccacgctaccgcaggaggtggtgatgagcctgtccaagtgctactcctccctgctggactcgatgaacgctgagatccgcatccgctggctgcagattgtggtccgcaacgactactatcctgacctccacagggtgcggcgcttcctggagagccagatgtcacgcatgtacaccatcccgctgtacgaggacctctgcaccggtgccctcaagtccttcgcgctggaggtcttctaccagacgcagggccggctgcaccccaacctgcgcagagccatccagcagatcctgtcccagggcctgggctccagcacagagcccgcctcagagcccagcacggagctgggcaaggctgaagcagacacagactcggacgcacaggccctgctgcttggggacgaggccaccagcagtgccatctctctcagggacgtcaatgtgtctgcctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ATG9 autophagy related 9 homolog B (S. cerevisiae) - retinal pigment epithelium-derived rhodopsin homolog - golgi autoantigen, golgin subfamily a, 2-like 1 - ATPase, (Na+)/K+ transporting, beta 4 polypeptide |