Cart 43 Product Products 6 759,98 € (empty)
-
1 x CALML5-cal...113,40 € -
1 x NCR3-natur...113,40 € -
1 x GSTM2-glut...113,40 € -
-
1 x LRRC8D-leu...113,40 € -
1 x DPH5-DPH5...113,40 € -
1 x WIBG-withi...113,40 € -
1 x DEFB134-de...113,40 € -
-
-
1 x IHPK2-inos...113,40 € -
1 x IFRD1-inte...121,50 € -
1 x CHRNB3-cho...121,50 € -
1 x NTF3-neuro...113,40 € -
1 x PNPLA3-pat...113,40 € -
1 x TOX2-TOX...121,50 € -
-
-
-
1 x WNK1-WNK...121,50 € -
1 x KDELR3-KDE...113,40 € -
1 x PACSIN1-pr...121,50 € -
1 x LXN-latexi...113,40 € -
1 x LOC728395-...113,40 € -
1 x MOGAT3-mon...121,50 € -
1 x Cell-Clock...409,00 € -
1 x SFXN1-side...113,40 € -
1 x FAM172A-fa...121,50 € -
1 x CYTL1-cyto...113,40 € -
1 x GTF2E2-gen...121,50 € -
1 x WDR77-WD...121,50 € -
-
1 x CYB5B-cyto...113,40 € -
1 x CYP3A43-cy...121,50 € -
-
-
-
-
1 x SIRT7-sirt...121,50 € -
-
1 x TRIM17-tri...121,50 € -
1 x Olfactory...259,07 € -
No products
To be determined Shipping
6 759,98 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 43 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 6 759,98 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 6 759,98 €
Data sheet of DAB1-disabled homolog 1 (Drosophila) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DAB1-disabled homolog 1 (Drosophila) Gene
| Brand: | ProteoGenix |
| Availability: | PRODUCT NOT AVAILABLE |
| Proteogenix catalog: | PTXBC112938 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DAB1 |
| Origin species: | Human |
| Product name: | DAB1-disabled homolog 1 (Drosophila) Gene |
| Size: | 2ug |
| Accessions: | BC112938 |
| Gene id: | 1600 |
| Gene description: | disabled homolog 1 (Drosophila) |
| Synonyms: | DAB1, reelin adaptor protein; disabled homolog 1; Dab reelin signal transducer 1; Dab, reelin signal transducer, homolog 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcaactgagacagaacttcaagtagctgtgaaaaccagcaccaagaaagactccagaaagaaaggtcaggatcgcagtgaagccactttgataaagaggtttaaaggtgaaggggtccggtacaaagccaaattgatcgggattgatgaagtttccgcagctcggggagacaagttatgtcaagattccatgatgaaactcaagggcgttgttgctggcgctcgttccaaaggagaacacaaacagaaaatctttttaaccatctcctttggaggaatcaaaatctttgatgagaagacaggggcccttcagcatcatcatgctgttcatgaaatatcctacattgcaaaggacattacagatcaccgggcctttggatatgtttgtgggaaggaagggaatcacagatttgtggccataaaaacagcccaggcggctgaacctgttattctggacttgagagatctctttcaactcatttatgaattgaagcaaagagaagaattagaaaaaaaggcacaaaaggataagcagtgtgaacaagctgtgtaccaggttcccaccagccaaaagaaggaaggtgtttatgatgtgccaaaaagtcaacctgtaagtaatggctattcgtttgaggattttgaagaacggtttgctgcagccaccccggctgtgacccaattagaactttttggggacatgtccacaccccctgatataacctctccccccactcctgcaactccaggtgatgcctttatcccatcttcatctcagacccttccagcgagtgcagatgtgtttagttctgtacctttcggcactgctgctgtaccctcaggttacgttgcaatgggcgctgtcctcccgtccttctggggtcagcagcccctcgtccaacagcagatggtcatgggtgcccagccaccagtcgctcaggtgatgccgggggctcagcccatcgcatggggccagccgggtctctttcctgccactcagcagccctggccaactgtggccgggcagtttccgccagccgccttcatgcccacacaaactgttatgcctttgccagctgccatgttccaaggtcccctcaccccccttgccaccgtcccaggcacgagtgactccaccaggtcaagtccacagaccgacaagcccaggcagaaaatgggcaaagaaacgtttaaggatttccagatggcccagcctccgcccgtgccctcccgcaaacccgaccagccctccctcacctgtacctcagaggccttctccagttacttcaacaaagtcggggtggcacaggatacagacgactgtgatgactttgacatctcccagttgaatttgacccctgtgacttctaccacaccatcgaccaactcacctccaaccccagcccctagacagagctctccatccaaatcatctgcatcccatgccagtgatcctaccacagatgacatctttgaagagggctttgaaagtcccagcaaaagcgaagagcaagaagctcctgatggatcacaggcctcatccaacagtgatccatttggtgagcccagtggggagcccagtggtgataatataagtccacaggccggtagctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - SEC14-like 4 (S. cerevisiae) - RAD9 homolog B (S. cerevisiae) - EDAR-associated death domain - hypothetical protein MGC3196 |