Cart 17 Product Products 3 162,65 € (empty)
-
-
-
-
-
-
1 x HEYL-hairy...121,50 € -
1 x ABHD2-abhy...121,50 € -
-
-
-
1 x HSP27...259,07 € -
1 x AMPKα2...259,07 € -
-
-
-
-
-
1 x TGF-beta2494,00 €
No products
To be determined Shipping
3 162,65 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 17 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 3 162,65 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 3 162,65 €
Data sheet of HHAT-hedgehog acyltransferase Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HHAT-hedgehog acyltransferase Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC039071 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HHAT |
| Origin species: | Human |
| Product name: | HHAT-hedgehog acyltransferase Gene |
| Size: | 2ug |
| Accessions: | BC039071 |
| Gene id: | 55733 |
| Gene description: | hedgehog acyltransferase |
| Synonyms: | protein-cysteine N-palmitoyltransferase HHAT; MART2; SKI1; Skn; melanoma antigen recognized by T-cells 2; skinny hedgehog protein 1; hedgehog acyltransferase |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctgccccgatgggaactggcactttacctacttgcctcactaggcttccacttctattccttctatgaagtttacaaagtctccagagaacacgaagaggagctggaccaggaatttgagctggagactgacactttatttggaggattaaagaaggatgcgaccgactttgagtggagcttctggatggaatgggggaagcagtggctggtgtggcttctccttggccacatggtagtgtctcaaatggccacactgctggcaagaaagcacagaccctggattctcatgctctatgggatgtgggcctgctggtgtgtgctggggacccctggtgtggctatggttttgctccataccaccatctctttctgcgtggcccagttccggtctcagctcctgacgtggctctgttctctcctcctcctctccacactgaggctgcagggtgtggaagaagttaagagaaggtggtacacagaaaacgagtactacctgctgcagttcacgctgaccgttcgctgcctctactacaccaacttcagcctggagctctgctggcagcagctgcctgctgcatcgacctcctactcctttccctggatgctggcctatgtcttttattatccagtcttacacaatgggcccatcctcagcttctcggagttcatcaaacagatgcagcagcaggagcatgactccctgaaggccagcctgtgtgtcctggccctggggctgggccgccttctttgctggtggtggctggccgagctgatggctcacctgatgtacatgcatgccatctacagcagcatccccctcctggagactgtctcttgttggaccttaggaggactggcgttagcccaggtgctctttttctacgtgaagtacttggtgctctttggcgtgcctgctctgctcatgcgcctggatggactcactccacccgccctcccccgctgcgtgagcaccatgttcagtttcaccgggatgtggaggtattttgatgttggactgcataatttcttaatcaggtatgtgtacattccagtgggcgggtcccagcatggcctgctggggacactgttttccacggcgatgacatttgcatttgtgagctactggcatggcggctacgactacctctggtgctgggcagcgctcaactggctgggagtcactgtggagaatggagtccggaggctggtggagactccctgcatccaggacagtctggcccgatacttctccccacaagctcgccgtcgattccacgctgcccttgcttcttgttccacctcgatgctgatcctgtccaacctggtatttcttgggggcaatgaggttgggaaaacctactggaataggatcttcatacaagtcctccctctgcaggctggccttgggtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - Ras and Rab interactor 2 - EMI domain containing 2 - visual system homeobox 2 - Rh blood group, D antigen |