Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
HNRNPH2-heterogeneous nuclear ribonucleoprotein H2 (H') Gene
PTXBC130343
New product
Data sheet of HNRNPH2-heterogeneous nuclear ribonucleoprotein H2 (H') Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HNRNPH2-heterogeneous nuclear ribonucleoprotein H2 (H') Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC130343 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HNRNPH2 |
| Origin species: | Human |
| Product name: | HNRNPH2-heterogeneous nuclear ribonucleoprotein H2 (H') Gene |
| Size: | 2ug |
| Accessions: | BC130343 |
| Gene id: | 3188 |
| Gene description: | heterogeneous nuclear ribonucleoprotein H2 (H') |
| Synonyms: | FTP3; HNRPH'; HNRPH2; MRXSB; hnRNPH'; heterogeneous nuclear ribonucleoprotein H2; FTP-3; heterogeneous nuclear ribonucleoprotein H-prime; hnRNP H'; hnRNP H2; heterogeneous nuclear ribonucleoprotein H2 (H') |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgatgctgagcacggaaggcagggaggggttcgtggtgaaggtcaggggcctaccctggtcctgctcagccgatgaagtgatgcgcttcttctctgattgcaagatccaaaatggcacatcaggtattcgtttcatctacaccagagaaggcagaccaagtggtgaagcatttgttgaacttgaatctgaagaggaagtgaaattggctttgaagaaggacagagaaaccatgggacacagatacgttgaagtattcaagtctaacagtgttgaaatggattgggtgttgaagcatacaggtccgaatagccctgatactgccaacgatggcttcgtccggcttagaggactcccatttggctgtagcaaggaagagattgttcagttcttttcagggttggaaattgtgccaaatgggatgacactgccagtggactttcaggggcgaagcacaggggaagcctttgtgcagtttgcttcacaggagatagctgagaaggccttaaagaaacacaaggaaagaatagggcacaggtacattgagatcttcaagagtagccgagctgaagttcgaacccactatgatccccctcgaaagctcatggctatgcagcggccaggtccctatgataggccgggggctggcagagggtataatagcattggcagaggagctgggtttgaaaggatgaggcgtggtgcctatggtggagggtatggaggctatgatgactatggtggctataatgatggatatggctttgggtctgatagatttggaagagacctcaattactgtttttcaggaatgtctgatcatagatacggagatggtgggtccagtttccagagcaccacagggcactgtgtacacatgagggggttaccttacagagccactgagaatgatatttataatttcttctcacctcttaatcccatgagagtacatattgaaattggacccgatggcagagttaccggtgaggcagatgttgaatttgctactcatgaagatgctgtggcagctatggcaaaagacaaagctaatatgcaacacagatatgtggagctcttcttaaattctactgcaggaacaagtgggggtgcttacgatcacagctatgtagaactttttttgaattctacagcaggggcaagtggtggcgcttatggtagccaaatgatgggagggatgggcttatccaaccagtctagttatggaggtcctgctagccagcagctgagtggtggttatggaggtggttatggtggtcagagcagtatgagtggatatgaccaagttctgcaggaaaactccagtgactatcagtcaaaccttgcttag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ectonucleoside triphosphate diphosphohydrolase 5 - major facilitator superfamily domain containing 1 - family with sequence similarity 108, member C1 - C1q and tumor necrosis factor related protein 3 |